Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043858 Arcobacter cibarius strain H743 plasmid pACIB, complete sequence 1 crisprs RT,WYL,PrimPol 0 1 3 0
NZ_CP043857 Arcobacter cibarius strain H743 chromosome, complete genome 0 crisprs cas4,DEDDh,PrimPol,WYL,csa3,c2c10_CAS-V-U3,RT,cas3 0 0 5 0

Results visualization

1. NZ_CP043858
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043858_1 39345-39461 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043858_1 1.1|39375|57|NZ_CP043858|CRISPRCasFinder 39375-39431 57 NZ_CP043858 Arcobacter cibarius strain H743 plasmid pACIB, complete sequence 39375-39431 0 1.0

1. spacer 1.1|39375|57|NZ_CP043858|CRISPRCasFinder matches to NZ_CP043858 (Arcobacter cibarius strain H743 plasmid pACIB, complete sequence) position: , mismatch: 0, identity: 1.0

taccacattttgtacaagtaattaaaacttctttttttacttctgttccacaagaat	CRISPR spacer
taccacattttgtacaagtaattaaaacttctttttttacttctgttccacaagaat	Protospacer
*********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61 : 65403 60 Leptospira_phage(29.41%) transposase NA
DBSCAN-SWA_2 76097 : 139108 58 uncultured_Caudovirales_phage(17.65%) integrase,transposase attL 104305:104326|attR 141365:141386
DBSCAN-SWA_3 178216 : 213981 34 Shigella_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP043857
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 196806 : 210415 13 Clostridioides_phage(12.5%) tRNA NA
DBSCAN-SWA_2 230095 : 237025 9 Campylobacter_virus(33.33%) tRNA NA
DBSCAN-SWA_3 480362 : 597998 108 Leptospira_phage(18.52%) tRNA,transposase NA
DBSCAN-SWA_4 854026 : 962628 97 Leptospira_phage(10.53%) protease,tRNA,integrase,transposase attL 947340:947358|attR 958678:958696
DBSCAN-SWA_5 1117814 : 1155267 33 Acidithiobacillus_phage(25.0%) tRNA,integrase,transposase attL 1144829:1144874|attR 1156257:1156302
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage