Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041452 Escherichia coli strain YPE3 chromosome, complete genome 9 crisprs csa3,PD-DExK,WYL,cas2,cas3,DEDDh,DinG,c2c9_V-U4,Cas14u_CAS-V 1 19 9 0
NZ_CP041451 Escherichia coli strain YPE3 plasmid pYPE3-114k, complete sequence 0 crisprs DEDDh 0 0 3 0
NZ_CP041450 Escherichia coli strain YPE3 plasmid pYPE3-Col, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 1 crisprs NA 0 1 1 0

Results visualization

1. NZ_CP041452
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_1 1026427-1026821 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_2 1047582-1048341 Unclear I-E
12 spacers
cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_3 1588695-1588812 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_4 2197862-2197985 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_5 2837118-2837209 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_6 3099410-3099554 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_7 3320468-3320564 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_8 3858722-3858856 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041452_9 3890696-3890837 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP041452.1 3921915-3921949 1 0.971

1. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to position: 3921915-3921949, mismatch: 1, identity: 0.971

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
ttcagcgcctgatgcgacgctggcgcgtcttatca	Protospacer
****.******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_KY020154 Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence 112539-112570 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_KY270851 Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence 180673-180704 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 213091-213122 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 160690-160721 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 256-287 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 15889-15920 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 237787-237818 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 227491-227522 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 229761-229792 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 16705-16736 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 45747-45778 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 96804-96835 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 156967-156998 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 89323-89354 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 171731-171762 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 121115-121146 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 237538-237569 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 31968-31999 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 308546-308577 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 235709-235740 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 141685-141716 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 206257-206288 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 161011-161042 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 58380-58411 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 102938-102969 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 162354-162385 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 154531-154562 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 217889-217920 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 160798-160829 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 161121-161152 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 161066-161097 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 27673-27704 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 302946-302977 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 159519-159550 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 39113-39144 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 160574-160605 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 160901-160932 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 162734-162765 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 160635-160666 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 161011-161042 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 160537-160568 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 158323-158354 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 152653-152684 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 152087-152118 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 160642-160673 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 160426-160457 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 98185-98216 0 1.0
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP027448 Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence 44629-44660 0 1.0
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 CP043735 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence 40067-40098 0 1.0
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP047660 Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence 58891-58922 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
NZ_CP041452_5 5.1|2837144|40|NZ_CP041452|CRISPRCasFinder 2837144-2837183 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 105238-105269 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 66553-66584 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 74796-74827 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 118045-118076 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 240380-240411 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 46729-46760 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 37723-37754 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 25676-25707 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 32465-32496 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 100635-100666 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 138368-138399 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 96788-96819 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 84184-84215 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 137391-137422 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 173749-173780 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 238532-238563 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 149374-149405 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 84184-84215 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 176730-176761 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 82749-82780 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 199740-199771 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 75569-75600 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 7793-7824 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 26064-26095 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 9386-9417 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 153222-153253 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 21836-21867 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 86682-86713 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 84185-84216 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 MH114596 Salmonella enterica strain 13-1681 plasmid p131681, complete sequence 146901-146932 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 227807-227838 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 194221-194252 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 100302-100333 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 213332-213363 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 67687-67718 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 116189-116220 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 124872-124903 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 93474-93505 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 93527-93558 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 185399-185430 1 0.969
NZ_CP041452_2 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047916-1047947 32 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 34232-34263 1 0.969
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101196-101230 1 0.971
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 143044-143075 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP050841 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence 71931-71962 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 66435-66466 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 98748-98779 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 66168-66199 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP012994 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence 2476-2507 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 49059-49090 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 132702-132733 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 108045-108076 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 87153-87184 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 287-318 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 33752-33783 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 67716-67747 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 25730-25761 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 57687-57718 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP019890 Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence 122841-122872 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 102403-102434 2 0.938
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 65860-65891 2 0.938
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
NZ_CP041452_2 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048281-1048312 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
NZ_CP041452_4 4.1|2197905|38|NZ_CP041452|CRISPRCasFinder 2197905-2197942 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP041452_1 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder 1026517-1026548 32 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3605 3 0.906
NZ_CP041452_1 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder 1026517-1026548 32 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3598 3 0.906
NZ_CP041452_1 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder 1026517-1026548 32 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21074 3 0.906
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56080-56114 3 0.914
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14148-14182 3 0.914
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 271-305 3 0.914
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31251-31285 3 0.914
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12112-12146 3 0.914
NZ_CP041452_1 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT 1026516-1026548 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
NZ_CP041452_1 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT 1026516-1026548 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
NZ_CP041452_1 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT 1026516-1026548 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165464-165498 4 0.886
NZ_CP041452_1 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder 1026517-1026548 32 KY653119 Morganella phage IME1369_02, complete genome 18217-18248 5 0.844
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87137-87171 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4114-4148 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208981-209015 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4113-4147 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219475-219509 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7392-7426 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84216-84250 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4113-4147 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210309-210343 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4113-4147 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191264-191298 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30177-30211 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 170-204 5 0.857
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 88-122 5 0.857
NZ_CP041452_1 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT 1026516-1026548 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 112048-112078 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 138722-138752 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 134876-134906 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 159432-159462 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 139796-139826 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 255946-255976 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 159432-159462 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 132848-132878 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 132849-132879 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 159441-159471 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 159459-159489 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 159431-159461 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 138736-138766 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 138734-138764 6 0.806
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 138733-138763 6 0.806
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_008562 Microcystis phage Ma-LMM01 DNA, complete genome 140086-140117 6 0.812
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014325 Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence 38109-38140 6 0.812
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3372-3406 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 43-77 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4013-4047 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208887-208921 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3371-3405 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 42-76 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4012-4046 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219381-219415 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3371-3405 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 42-76 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4012-4046 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210215-210249 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3371-3405 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 42-76 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4012-4046 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191170-191204 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15018-15052 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18350-18384 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 14272-14306 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41415-41449 6 0.829
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NC_049343 Escherichia phage 500465-2, complete genome 28333-28367 6 0.829
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24789-24826 6 0.842
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24902-24939 6 0.842
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4073-4110 6 0.842
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4072-4109 6 0.842
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4072-4109 6 0.842
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4072-4109 6 0.842
NZ_CP041452_1 1.9|1026578|32|NZ_CP041452|CRISPRCasFinder 1026578-1026609 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755173-755204 7 0.781
NZ_CP041452_2 2.1|1047611|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047611-1047642 32 NC_021623 Borrelia hermsii strain HS1 plasmid lp174, complete sequence 117325-117356 7 0.781
NZ_CP041452_2 2.1|1047611|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047611-1047642 32 NZ_CP014350 Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence 126529-126560 7 0.781
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 372200-372231 7 0.781
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP009154 Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence 17332-17362 7 0.774
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP044019 Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence 94508-94539 7 0.781
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013516 Streptobacillus moniliformis DSM 12112 plasmid pSMON01, complete sequence 7628-7659 7 0.781
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP027399 Streptobacillus moniliformis strain FDAARGOS_310 plasmid unnamed, complete sequence 1421-1452 7 0.781
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 LN681534 Clostridium phage phiCD24-1, complete genome 11241-11272 7 0.781
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MN718463 Clostridium phage phiCDKH01, complete genome 30675-30706 7 0.781
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61916-61950 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 6804-6838 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 13988-14022 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229148-229182 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229249-229283 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229350-229384 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229451-229485 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239642-239676 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239743-239777 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239844-239878 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239945-239979 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6744-6778 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83590-83624 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230554-230588 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230655-230689 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230756-230790 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230857-230891 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211524-211558 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211625-211659 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211726-211760 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211827-211861 7 0.8
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 118733-118767 7 0.8
NZ_CP041452_1 1.3|1026577|33|NZ_CP041452|PILER-CR,CRT 1026577-1026609 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP041452_1 1.9|1026578|32|NZ_CP041452|CRISPRCasFinder 1026578-1026609 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191951 8 0.75
NZ_CP041452_1 1.12|1026761|32|NZ_CP041452|CRISPRCasFinder 1026761-1026792 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1470278-1470308 8 0.742
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 7608-7638 8 0.742
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 7168-7198 8 0.742
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 94061-94091 8 0.742
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 9778-9808 8 0.742
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP037738 Citrobacter freundii strain CAV1857 plasmid pCAV1857-47, complete sequence 45049-45080 8 0.75
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_MF344556 Enterobacter cloacae strain 30860 plasmid p30860-NR, complete sequence 9368-9399 8 0.75
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK448998 Streptococcus phage Javan636, complete genome 14722-14753 8 0.75
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP023400 Pseudoalteromonas spongiae strain SAO4-4 plasmid pl, complete sequence 41988-42019 8 0.75
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK318083 Aeromonas phage Akh-2, complete genome 49017-49048 8 0.75
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3331-3368 8 0.789
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3330-3367 8 0.789
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3330-3367 8 0.789
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3330-3367 8 0.789
NZ_CP041452_1 1.7|1026456|32|NZ_CP041452|CRISPRCasFinder 1026456-1026487 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246573-246604 9 0.719
NZ_CP041452_2 2.2|1047672|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047672-1047703 32 MN693721 Marine virus AFVG_250M181, complete genome 13812-13843 9 0.719
NZ_CP041452_2 2.7|1047977|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047977-1048008 32 NZ_CP041206 Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence 474256-474287 9 0.719
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 739494-739524 9 0.71
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 694600-694630 9 0.71
NZ_CP041452_2 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048038-1048068 31 AP014383 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS *** 34869-34899 9 0.71
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_015919 Borreliella bissettii DN127 plasmid lp54, complete sequence 25464-25495 9 0.719
NZ_CP041452_8 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder 3858772-3858806 35 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 64295-64329 9 0.743
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14114-14151 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51843-51880 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229388-229425 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239882-239919 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230794-230831 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211764-211801 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40383-40420 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313601-313638 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386517-386554 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397090-397127 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404135-404172 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 114998-115035 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40307-40344 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 103-140 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31308-31345 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8897-8934 9 0.763
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 17901-17938 9 0.763
NZ_CP041452_1 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder 1026517-1026548 32 MF158039 Shigella phage Sf12, complete genome 4975-5006 10 0.688
NZ_CP041452_1 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder 1026517-1026548 32 MF158042 Shigella phage Sd1, complete genome 938-969 10 0.688
NZ_CP041452_2 2.1|1047611|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047611-1047642 32 MK613349 Roseobacter phage CRP-7, complete genome 23520-23551 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 JB137888 Sequence 7 from Patent WO2012159774 23018-23049 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 KJ094025 Listeria phage LP-032 contig 2, partial genome 11870-11901 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 MN114083 Listeria phage LP-013, complete genome 25654-25685 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 MN128593 Listeria phage LP-031, complete genome 25617-25648 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 NC_021787 Listeria phage LP-037, complete genome 48031-48062 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 MN904502 Listeria phage LP-018, complete genome 25117-25148 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 JX442241 Listeria phage P70, complete genome 31182-31213 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 KJ094020 Listeria phage LP-026, complete genome 8121-8152 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 KJ094021 Listeria phage LP-114, complete genome 14545-14576 10 0.688
NZ_CP041452_2 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1047794-1047825 32 MN114082 Listeria phage LP-010, complete genome 25655-25686 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 336675-336706 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1404898-1404929 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1367023-1367054 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 335612-335643 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1471121-1471152 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1573137-1573168 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 331703-331734 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 330856-330887 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 969811-969842 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 949767-949798 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 677508-677539 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 581426-581457 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1091515-1091546 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 212989-213020 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 631547-631578 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1119650-1119681 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 683917-683948 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 335137-335168 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1523229-1523260 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1299620-1299651 10 0.688
NZ_CP041452_2 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048098-1048129 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1404905-1404936 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_016942 Staphylococcus argenteus MSHR1132 plasmid pST75 complete sequence 5299-5330 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP029750 Staphylococcus aureus strain Smith plasmid pSS41, complete sequence 37023-37054 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030488 Staphylococcus aureus strain ER01009.3 plasmid unnamed1, complete sequence 15239-15270 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030517 Staphylococcus aureus strain ER01116.3 plasmid unnamed2, complete sequence 3411-3442 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030707 Staphylococcus aureus strain ER03493.3 plasmid unnamed1, complete sequence 14760-14791 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP053186 Staphylococcus aureus strain Guangzhou-SAU749 plasmid pSAU749, complete sequence 13516-13547 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP016857 Staphylococcus aureus subsp. aureus strain 1971.C01 plasmid p1971.C01c, complete sequence 26128-26159 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP053184 Staphylococcus aureus strain Guangzhou-SAU071 plasmid pSAU071, complete sequence 21385-21416 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030633 Staphylococcus aureus strain ER03755.3 plasmid unnamed1, complete sequence 12815-12846 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP013228 UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence 8986-9017 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP013228 UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence 36054-36085 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP013229 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence 2612-2643 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP013229 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence 29549-29580 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP013230 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_4, complete sequence 7844-7875 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP030325 Staphylococcus aureus strain AR_474 plasmid unnamed1, complete sequence 20301-20332 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_018956 Staphylococcus aureus plasmid p18806-P03, complete sequence 668-699 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP018767 Staphylococcus aureus subsp. aureus strain UCI62 plasmid pUCI62, complete sequence 6436-6467 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030383 Staphylococcus aureus strain ER03761.3 plasmid unnamed2, complete sequence 22947-22978 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030587 Staphylococcus aureus strain ER00594.3 plasmid unnamed1, complete sequence 25607-25638 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030607 Staphylococcus aureus strain ER02693.3 plasmid unnamed2, complete sequence 17509-17540 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030663 Staphylococcus aureus strain ER03489.3 plasmid unnamed1, complete sequence 14708-14739 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP039449 Staphylococcus aureus strain VGC1 plasmid pVGC1_1, complete sequence 899-930 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030385 Staphylococcus aureus strain ER00959.3 plasmid unnamed1, complete sequence 25939-25970 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030530 Staphylococcus aureus strain ER04421.3 plasmid unnamed1, complete sequence 12165-12196 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014408 Staphylococcus aureus strain USA300-SUR12 plasmid pUSA04-1-SUR12, complete sequence 15980-16011 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014411 Staphylococcus aureus strain USA300-SUR13 plasmid pUSA04-1-SUR13, complete sequence 15950-15981 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014367 Staphylococcus aureus strain USA300-SUR2 plasmid pUSA04-1-SUR2, complete sequence 15950-15981 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP054441 Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-1, complete sequence 24016-24047 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 LC383633 Staphylococcus aureus SI1 plasmid pWSI1 DNA, complete sequence 21436-21467 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP031889 Staphylococcus aureus strain CFSAN082782 plasmid pMRSA_23, complete sequence 17895-17926 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030387 Staphylococcus aureus strain ER01062.3 plasmid unnamed1, complete sequence 19330-19361 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030513 Staphylococcus aureus strain ER01817.3 plasmid unnamed1, complete sequence 25938-25969 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030666 Staphylococcus aureus strain ER01454.3 plasmid unnamed1, complete sequence 15479-15510 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014386 Staphylococcus aureus strain USA300-SUR7 plasmid pUSA04-3-SUR7, complete sequence 15017-15048 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030397 Staphylococcus aureus strain ER01719.3 plasmid unnamed1, complete sequence 17149-17180 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030414 Staphylococcus aureus strain ER03113.3 plasmid unnamed1, complete sequence 25948-25979 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP011527 Staphylococcus aureus subsp. aureus DSM 20231 plasmid unnamed, complete sequence 9393-9424 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030497 Staphylococcus aureus strain ER02658.3 plasmid unnamed1, complete sequence 23633-23664 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP013956 Staphylococcus aureus strain NCCP14562 isolate Sequencing plasmid pNCCP14562, complete sequence 23708-23739 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_003140 Staphylococcus aureus subsp. aureus N315 plasmid pN315, complete sequence 899-930 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP016862 Staphylococcus aureus subsp. aureus strain 1625.C01 plasmid p1625.C01, complete sequence 19070-19101 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_010419 Staphylococcus aureus plasmid pTZ2162, complete sequence 34334-34365 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP013954 Staphylococcus aureus strain NCCP14558 plasmid pNCCP14558, complete sequence 17875-17906 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030416 Staphylococcus aureus strain ER01836.3 plasmid unnamed1, complete sequence 19505-19536 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030477 Staphylococcus aureus strain ER04436.3 plasmid unnamed1, complete sequence 13032-13063 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030521 Staphylococcus aureus strain ER01564.3 plasmid unnamed1, complete sequence 7859-7890 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP012975 Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence 659-690 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_LR130519 Staphylococcus aureus strain BPH2986 isolate BPH2986 plasmid 2 25866-25897 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP020323 Staphylococcus aureus strain KUH180129 plasmid p01KUH180129, complete sequence 647-678 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030444 Staphylococcus aureus strain ER01838.3 plasmid unnamed1, complete sequence 25920-25951 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030533 Staphylococcus aureus strain ER02495.3 plasmid unnamed1, complete sequence 14862-14893 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014434 Staphylococcus aureus strain USA300-SUR20 plasmid pUSA04-1-SUR20, complete sequence 15950-15981 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_010077 Staphylococcus aureus plasmid EDINA, complete sequence 21421-21452 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030466 Staphylococcus aureus strain ER04235.3 plasmid unnamed1, complete sequence 15690-15721 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030555 Staphylococcus aureus strain PS00003.3 plasmid unnamed2, complete sequence 22953-22984 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP011529 Staphylococcus aureus strain RKI4 plasmid unnamed, complete sequence 659-690 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013289 Staphylococcus aureus plasmid SAP015A, complete sequence 8040-8071 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013292 Staphylococcus aureus plasmid pWBG752, complete sequence 9031-9062 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013294 Staphylococcus aureus plasmid SAP046A, complete sequence 15950-15981 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013296 Staphylococcus aureus plasmid SAP049A, complete sequence 14146-14177 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013298 Staphylococcus aureus plasmid SAP050A, complete sequence 23118-23149 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013299 Staphylococcus aureus plasmid SAP051A, complete sequence 5070-5101 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_018952 Staphylococcus aureus plasmid pWBG747, complete sequence 3829-3860 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP029677 Staphylococcus aureus strain AR_0216 plasmid unnamed2, complete sequence 7608-7639 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP035102 Staphylococcus aureus subsp. aureus strain ATCC 12600 plasmid unnamed, complete sequence 26596-26627 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP029199 Staphylococcus aureus strain aureus plasmid pFORC_090.1, complete sequence 11131-11162 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030523 Staphylococcus aureus strain ER04163.3 plasmid unnamed1, complete sequence 13725-13756 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030616 Staphylococcus aureus strain ER01560.3 plasmid unnamed2, complete sequence 18237-18268 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 LC377540 Staphylococcus aureus plasmid pNTUH_5066148 NTUH_5066148 DNA, complete sequence 899-930 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_019150 Staphylococcus aureus plasmid p18805-P03, complete sequence 667-698 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_019148 Staphylococcus aureus PM1 plasmid pPM1, complete sequence 20952-20983 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030442 Staphylococcus aureus strain ER04385.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030494 Staphylococcus aureus strain ER03857.3 plasmid unnamed1, complete sequence 12813-12844 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030698 Staphylococcus aureus strain ER01334.3 plasmid unnamed1, complete sequence 18913-18944 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014063 Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence 17439-17470 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP007679 Staphylococcus aureus strain HUV05 plasmid pHUV05-03, complete sequence 30489-30520 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP030324 Staphylococcus aureus strain AR_475 plasmid unnamed1, complete sequence 23370-23401 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933272 Staphylococcus aureus subsp. aureus plasmid p4456, complete sequence 23155-23186 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933273 Staphylococcus aureus subsp. aureus plasmid p6092, complete sequence 15714-15745 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933274 Staphylococcus aureus subsp. aureus plasmid p6306, complete sequence 20951-20982 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933275 Staphylococcus aureus subsp. aureus plasmid p6414-1, complete sequence 17919-17950 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933276 Staphylococcus aureus subsp. aureus plasmid p6530, complete sequence 20954-20985 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP017095 Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.C01b, complete sequence 19097-19128 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_005127 Staphylococcus aureus plasmid pUB101, complete sequence 3611-3642 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933268 Staphylococcus aureus subsp. aureus plasmid p4578, complete sequence 23155-23186 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933269 Staphylococcus aureus subsp. aureus plasmid p2-1850, complete sequence 15714-15745 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933270 Staphylococcus aureus subsp. aureus plasmid p1070, complete sequence 20848-20879 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MK933271 Staphylococcus aureus subsp. aureus plasmid p2575, complete sequence 20950-20981 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP020314 Staphylococcus aureus strain KUH140046 plasmid p01KUH140046, complete sequence 11249-11280 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP012118 Staphylococcus aureus subsp. aureus strain USA300_2014.C01 plasmid pC01, complete sequence 19046-19077 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030571 Staphylococcus aureus strain ER01892.3 plasmid unnamed2, complete sequence 22947-22978 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030567 Staphylococcus aureus strain ER04242.3 plasmid unnamed1, complete sequence 15482-15513 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030461 Staphylococcus aureus strain ER04013.3 plasmid unnamed3, complete sequence 11132-11163 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030535 Staphylococcus aureus strain ER00749.3 plasmid unnamed1, complete sequence 3041-3072 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030643 Staphylococcus aureus strain ER00385.3 plasmid unnamed1, complete sequence 14712-14743 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030669 Staphylococcus aureus strain ER00951.3 plasmid unnamed1, complete sequence 22947-22978 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030623 Staphylococcus aureus strain ER01524.3 plasmid unnamed3, complete sequence 1460-1491 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013322 Staphylococcus aureus plasmid SAP019A, complete sequence 17285-17316 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013324 Staphylococcus aureus plasmid SAP027A, complete sequence 12132-12163 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013326 Staphylococcus aureus plasmid pWBG746, complete sequence 18676-18707 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013330 Staphylococcus aureus plasmid pWBG759, complete sequence 14220-14251 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013332 Staphylococcus aureus plasmid SAP052A, complete sequence 21512-21543 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013348 Staphylococcus aureus plasmid pSK156, complete sequence 14549-14580 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030463 Staphylococcus aureus strain ER00695.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030697 Staphylococcus aureus strain ER01532.3 plasmid unnamed2, complete sequence 22984-23015 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_023278 Staphylococcus aureus strain SA268 plasmid pSA268, complete sequence 15133-15164 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP040802 Staphylococcus aureus strain S15 plasmid unnamed1, complete sequence 16440-16471 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030446 Staphylococcus aureus strain ER04127.3 plasmid unnamed1, complete sequence 12813-12844 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030536 Staphylococcus aureus strain ER02094.3 plasmid unnamed1, complete sequence 15475-15506 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030660 Staphylococcus aureus strain ER02217.3 plasmid unnamed1, complete sequence 24585-24616 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP025250 Staphylococcus argenteus strain XNO106 plasmid unnamed, complete sequence 16154-16185 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030539 Staphylococcus aureus strain ER01935.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030690 Staphylococcus aureus strain ER01507.3 plasmid unnamed1, complete sequence 17158-17189 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP047853 Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence 2010-2041 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP047848 Staphylococcus aureus strain UP_522 plasmid unnamed, complete sequence 3612-3643 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP009362 Staphylococcus aureus subsp. aureus strain ATCC 25923 plasmid pS1945, complete sequence 17342-17373 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP007177 Staphylococcus aureus USA300-ISMMS1 plasmid pUSA01-ISMMS, complete sequence 899-930 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP029079 Staphylococcus aureus strain AR466 plasmid unnamed1, complete sequence 7866-7897 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_007931 Staphylococcus aureus plasmid pSA1379, complete sequence 668-699 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_018957 Staphylococcus aureus plasmid p18807-P03, complete sequence 668-699 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_018959 Staphylococcus aureus plasmid p18808-P03, complete sequence 662-693 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_018961 Staphylococcus aureus plasmid p18809-P03, complete sequence 668-699 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_018963 Staphylococcus aureus plasmid p18810-P03, complete sequence 667-698 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_018974 Staphylococcus aureus plasmid p18811-P03, complete sequence 669-700 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030700 Staphylococcus aureus strain ER03023.3 plasmid unnamed1, complete sequence 25950-25981 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014394 Staphylococcus aureus strain USA300-SUR9 plasmid pUSA04-2-SUR9, complete sequence 18871-18902 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP020325 Staphylococcus aureus strain KUN1163 plasmid p01KUN1163, complete sequence 647-678 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP020319 Staphylococcus aureus strain KUH180038 plasmid p01KUH180038, complete sequence 647-678 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014414 Staphylococcus aureus strain USA300-SUR14 plasmid pUSA04-1-SUR14, complete sequence 15950-15981 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP025497 Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence 41779-41810 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP025497 Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence 56386-56417 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030672 Staphylococcus aureus strain pt053 plasmid unnamed1, complete sequence 12814-12845 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030433 Staphylococcus aureus strain ER00610.3 plasmid unnamed1, complete sequence 22947-22978 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030528 Staphylococcus aureus strain ER02703.3 plasmid unnamed2, complete sequence 18895-18926 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030625 Staphylococcus aureus strain ER03448.3 plasmid unnamed1, complete sequence 20623-20654 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030644 Staphylococcus aureus strain ER03298.3 plasmid unnamed1, complete sequence 25902-25933 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP047831 Staphylococcus aureus strain UP_996 plasmid unnamed1, complete sequence 17727-17758 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP047836 Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence 4515-4546 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP048646 Staphylococcus aureus strain SR153 plasmid pSR03, complete sequence 22813-22844 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030436 Staphylococcus aureus strain ER04086.3 plasmid unnamed1, complete sequence 4976-5007 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP019544 Staphylococcus aureus strain KG-18 plasmid pKG-18, complete sequence 6047-6078 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP019546 Staphylococcus aureus strain KG-22 plasmid pKG-22, complete sequence 7961-7992 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_013550 Staphylococcus aureus plasmid pBORa53, complete sequence 13204-13235 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030629 Staphylococcus aureus strain ER03809.3 plasmid unnamed1, complete sequence 25787-25818 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030597 Staphylococcus aureus strain ER02443.3 plasmid unnamed1, complete sequence 12813-12844 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030662 Staphylococcus aureus strain ER02826.3 plasmid unnamed1, complete sequence 12348-12379 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP016860 Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence 41779-41810 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP016860 Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence 56386-56417 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP012121 Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence 41814-41845 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP012121 Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence 56421-56452 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP053635 Staphylococcus aureus strain 14638 plasmid unnamed, complete sequence 8278-8309 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030676 Staphylococcus aureus strain ER01533.3 plasmid unnamed2, complete sequence 667-698 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP020021 Staphylococcus aureus subsp. aureus strain ATCC 6538 plasmid unnamed1, complete sequence 13316-13347 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MN909556 Staphylococcus saprophyticus strain 1005578 plasmid p1005578_vga, complete sequence 31179-31210 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030425 Staphylococcus aureus strain ER00551.3 plasmid unnamed1, complete sequence 12269-12300 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030602 Staphylococcus aureus strain ER00658.3 plasmid unnamed2, complete sequence 22947-22978 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030598 Staphylococcus aureus strain ER02524.3 plasmid unnamed1, complete sequence 4931-4962 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP020312 Staphylococcus aureus strain KUH140013 plasmid p01KUH140013, complete sequence 21359-21390 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP020321 Staphylococcus aureus strain KUH180062 plasmid p01KUH180062, complete sequence 647-678 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030427 Staphylococcus aureus strain ER04320.3 plasmid unnamed1, complete sequence 25944-25975 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 9620-9651 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP014943 Staphylococcus aureus strain FDA209P plasmid pFDA209P, complete sequence 899-930 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030576 Staphylococcus aureus strain ER03910.3 plasmid unnamed1, complete sequence 667-698 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030649 Staphylococcus aureus strain ER03556.3 plasmid unnamed2, complete sequence 22953-22984 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP047857 Staphylococcus aureus strain UP_1435 plasmid unnamed1, complete sequence 9719-9750 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP053637 Staphylococcus aureus strain 14640 plasmid unnamed, complete sequence 12644-12675 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP031887 Staphylococcus aureus strain CFSAN082783 plasmid pMRSA_24, complete sequence 47280-47311 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030408 Staphylococcus aureus strain PS00002.3 plasmid unnamed2, complete sequence 22948-22979 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030578 Staphylococcus aureus strain ER01881.3 plasmid unnamed2, complete sequence 14490-14521 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030694 Staphylococcus aureus strain ER01803.3 plasmid unnamed1, complete sequence 12813-12844 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP040999 Staphylococcus aureus strain FDAARGOS_773 plasmid unnamed1, complete sequence 9425-9456 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP047842 Staphylococcus aureus strain UP_644 plasmid unnamed, complete sequence 10849-10880 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_AP014922 Staphylococcus aureus strain JH4899 plasmid pJSA01, complete sequence 21443-21474 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030560 Staphylococcus aureus strain ER01457.3 plasmid unnamed2, complete sequence 24585-24616 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030714 Staphylococcus aureus strain ER02878.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP029666 Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence 3562-3593 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014404 Staphylococcus aureus strain USA300-SUR11 plasmid pUSA04-2-SUR11, complete sequence 18871-18902 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030485 Staphylococcus aureus strain ER03913.3 plasmid unnamed3, complete sequence 17712-17743 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP021906 Staphylococcus aureus strain Seattle 1945 isolate G477 plasmid pG477, complete sequence 17341-17372 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP029665 Staphylococcus aureus strain AR_0226 plasmid unnamed1, complete sequence 8863-8894 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP016854 Staphylococcus aureus subsp. aureus strain 5118.N plasmid p5118.Nb, complete sequence 31240-31271 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030376 Staphylococcus aureus strain ER04041.3 plasmid unnamed2, complete sequence 14116-14147 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030563 Staphylococcus aureus strain ER03720.3 plasmid unnamed1, complete sequence 25949-25980 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030680 Staphylococcus aureus strain ER00573.3 plasmid unnamed3, complete sequence 16732-16763 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_017345 Staphylococcus aureus subsp. aureus TCH60 plasmid unnamed, complete sequence 7115-7146 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030509 Staphylococcus aureus strain ER00707.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030584 Staphylococcus aureus strain ER02262.3 plasmid unnamed1, complete sequence 22889-22920 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_009619 Staphylococcus aureus subsp. aureus JH1 plasmid pSJH101, complete sequence 4854-4885 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP044105 Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence 6241-6272 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030401 Staphylococcus aureus strain ER02637.3 plasmid unnamed2, complete sequence 22947-22978 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030409 Staphylococcus aureus strain ER03996.3 plasmid unnamed1, complete sequence 25300-25331 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030473 Staphylococcus aureus strain ER00767.3 plasmid unnamed1, complete sequence 5945-5976 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030549 Staphylococcus aureus strain ER03928.3 plasmid unnamed1, complete sequence 25300-25331 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP043303 Staphylococcus aureus strain 16445 plasmid unnamed1, complete sequence 26366-26397 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP039996 Staphylococcus aureus subsp. aureus M013 plasmid pM013, complete sequence 899-930 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP014364 Staphylococcus aureus strain USA300-SUR1 plasmid pUSA04-1-SUR1, complete sequence 15950-15981 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP054445 Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-1, complete sequence 24443-24474 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP040621 Staphylococcus aureus strain J01 plasmid pJ01-02, complete sequence 26370-26401 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP053638 Staphylococcus aureus strain 14732 plasmid unnamed, complete sequence 22613-22644 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030593 Staphylococcus aureus strain ER02989.3 plasmid unnamed2, complete sequence 15475-15506 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030511 Staphylococcus aureus strain ER04636.3 plasmid unnamed1, complete sequence 25946-25977 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_010063 Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence 899-930 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_MH068822 Staphylococcus argenteus strain XNO62 plasmid pXNO62, complete sequence 6049-6080 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_MH587574 Staphylococcus aureus strain WBG10514 plasmid pWBG731, complete sequence 680-711 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_MH785258 Staphylococcus aureus strain ph1 plasmid pPH1-2, complete sequence 5698-5729 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP042047 Staphylococcus aureus strain B2-7A plasmid pSALNBL75, complete sequence 34719-34750 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030405 Staphylococcus aureus strain ER04219.3 plasmid unnamed1, complete sequence 15469-15500 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030565 Staphylococcus aureus strain ER01989.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP022608 Staphylococcus aureus strain FORC_061 plasmid pFORC61_2, complete sequence 6784-6815 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_021552 Staphylococcus aureus CA-347 plasmid, complete sequence 899-930 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP031891 Staphylococcus aureus strain CFSAN082781 plasmid pMRSA_22, complete sequence 18710-18741 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NC_009477 Staphylococcus aureus subsp. aureus JH9 plasmid pSJH901, complete sequence 19663-19694 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030519 Staphylococcus aureus strain ER04332.3 plasmid unnamed1, complete sequence 456-487 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 CP030657 Staphylococcus aureus strain ER04448.3 plasmid unnamed2, complete sequence 4976-5007 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 NZ_CP045473 Staphylococcus aureus strain ZY05 plasmid pZY05, complete sequence 11777-11808 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MG757166 Gordonia phage SuperSulley, complete genome 59774-59805 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MF919510 Gordonia phage Kabluna, complete genome 58585-58616 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MH598798 Pelagibacter phage HTVC022P, complete genome 1600-1631 10 0.688
NZ_CP041452_2 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT 1048159-1048190 32 MH779499 Gordonia phage Buggaboo, complete genome 59774-59805 10 0.688
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56040-56077 10 0.737
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 58275-58312 10 0.737
NZ_CP041452_9 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder 3890748-3890785 38 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30215-30252 10 0.737
NZ_CP041452_1 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT 1026516-1026548 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP041452_1 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT 1026516-1026548 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667

1. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY020154 (Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

2. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

3. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

4. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

5. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

6. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

7. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

8. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

9. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

10. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

11. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

12. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

13. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

14. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

15. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

16. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

17. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

18. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

19. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

20. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

21. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

22. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

23. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

24. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

25. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

26. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

27. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

28. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

29. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

30. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

31. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

32. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

33. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

34. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

35. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

36. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

37. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

38. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

39. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

40. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

41. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

42. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

43. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

44. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

45. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

46. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

47. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

48. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

49. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

50. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

51. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg	Protospacer
********************************

52. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP043735 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg	Protospacer
********************************

53. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047660 (Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg	Protospacer
********************************

54. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

55. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

56. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

57. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

58. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

59. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

60. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

61. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

62. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

63. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

64. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

65. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

66. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

67. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

68. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

69. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

70. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

71. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

72. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

73. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

74. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

75. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

76. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

77. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

78. spacer 5.1|2837144|40|NZ_CP041452|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

79. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

80. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

81. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

82. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

83. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

84. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

85. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

86. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

87. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

88. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

89. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

90. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

91. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

92. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

93. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

94. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

95. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

96. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

97. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

98. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

99. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

100. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

101. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

102. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

103. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

104. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

105. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

106. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

107. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

108. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MH114596 (Salmonella enterica strain 13-1681 plasmid p131681, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

109. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

110. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

111. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

112. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

113. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

114. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

115. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

116. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

117. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

118. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

119. spacer 2.6|1047916|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

120. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.971

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
ttcagcgcctgatgcgacgctggcgcgtcttatca	Protospacer
****.******************************

121. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

122. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

123. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

124. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

125. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

126. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

127. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

128. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

129. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

130. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

131. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

132. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

133. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

134. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

135. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

136. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019890 (Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

137. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

138. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 2, identity: 0.938

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

139. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

140. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

141. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

142. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

143. spacer 2.12|1048281|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt	Protospacer
************ * *****************

144. spacer 4.1|2197905|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

145. spacer 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

146. spacer 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

147. spacer 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

148. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 3, identity: 0.914

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
ctcaacgcctgatgcgacgctggcgcgtcttagcg	Protospacer
.******************************* *.

149. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 3, identity: 0.914

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
atcaacgcctgatgcgtcgctgtcgcgtcttatca	Protospacer
 *************** ***** ************

150. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 3, identity: 0.914

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
atcaatgcctgatgcgacgctgtcgcgtcttatca	Protospacer
 ****.**************** ************

151. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 3, identity: 0.914

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
atcaatgcctgatgcgacgctgtcgcgtcttatca	Protospacer
 ****.**************** ************

152. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 3, identity: 0.914

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
ttcggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
***...*****************************

153. spacer 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

154. spacer 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

155. spacer 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

156. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 4, identity: 0.886

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
tgtaacgcctgatgcgacgctgacgcgtcttatct	Protospacer
* .*******************.*********** 

157. spacer 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggttgtgcggcgttaacgctgaccagcatttc	Protospacer
*  * ******.******** ***********

158. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
cacgatgcctgatgcgacgctgccgcgtcttatca	Protospacer
. *.*.**************** ************

159. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.*****************************

160. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. .*.****************.************

161. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.*****************************

162. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. .*.****************.************

163. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. .*.*****************************

164. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. .*.*****************************

165. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.*****************************

166. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. .*.****************.************

167. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.*****************************

168. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. .*.****************.************

169. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
tctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*...*.****************.************

170. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
attgaagcctgatgcgacgctgacgcgtcttatca	Protospacer
 *..* ****************.************

171. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 5, identity: 0.857

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .*.*.****************.************

172. spacer 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
aggttgtgcggcgttaacgctgaccagcatttc	Protospacer
 *  * ******.******** ***********

173. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gcggtcaaatccggcgagccgccggcgctct	Protospacer
 **  *******.***********.***** 

174. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

175. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

176. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

177. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

178. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.806

-ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ttcgcg-gcatccagcgtgccgccgtcgctca	Protospacer
 .**** . ******** ******* ******

179. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

180. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

181. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

182. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

183. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

184. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

185. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

186. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

187. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

188. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 6, identity: 0.812

attgttataattatttattgaaatatcattcc	CRISPR spacer
attgttagaattaattattgaaataatcatcc	Protospacer
******* ***** *********** .  ***

189. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014325 (Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence) position: , mismatch: 6, identity: 0.812

attgttataattatttattgaaatatcattcc-	CRISPR spacer
tttgttataattatttttagaaat-tcattaaa	Protospacer
 *************** * ***** *****   

190. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...*****************************

191. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 ...*.****************.************

192. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . .*.***************.*************

193. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*.*.****************.*****.******

194. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...*****************************

195. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 ...*.****************.************

196. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . .*.***************.*************

197. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*.*.****************.*****.******

198. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...*****************************

199. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 ...*.****************.************

200. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . .*.***************.*************

201. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*.*.****************.*****.******

202. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...*****************************

203. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 ...*.****************.************

204. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . .*.***************.*************

205. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*.*.****************.*****.******

206. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
ccaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...*****************************

207. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 ...*.****************.************

208. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
tgaattacctgatgcgacgctggcgcatcttatca	Protospacer
*  * ..*******************.********

209. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gctgatgtctgatgcgacgctggcgcgtcttatca	Protospacer
 ...*.*.***************************

210. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 6, identity: 0.829

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
cgtaacgtcggatgcgacgctggcgcgtcttatcc	Protospacer
. .****.* ************************ 

211. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

212. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

213. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

214. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

215. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

216. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

217. spacer 1.9|1026578|32|NZ_CP041452|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
ccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
 *******.**************** *.. *.

218. spacer 2.1|1047611|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_021623 (Borrelia hermsii strain HS1 plasmid lp174, complete sequence) position: , mismatch: 7, identity: 0.781

-gcagtaaattatttgacctcgttgataatccc	CRISPR spacer
cgcag-aaattttttgaccttgttgataagttt	Protospacer
 **** ***** ********.******** ...

219. spacer 2.1|1047611|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

-gcagtaaattatttgacctcgttgataatccc	CRISPR spacer
cgcag-aaattttttgaccttgttgataagttt	Protospacer
 **** ***** ********.******** ...

220. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tgtatcacc----gaaagaatggtttgacgcgcagg	CRISPR spacer
----tcatcccatgaaagaatgggttgaggcgcagg	Protospacer
    ***.*    ********** **** *******

221. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009154 (Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

ccgcgcaaatccagcgagccgccgacgctca---	CRISPR spacer
gcccgcacattcagcgagccgccgac---caagc	Protospacer
 * **** **.***************   **   

222. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044019 (Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence) position: , mismatch: 7, identity: 0.781

attgttataattatttattgaaatatcattcc--	CRISPR spacer
tttgttataattatctatagaa--atcaatgctg	Protospacer
 *************.*** ***  **** * *  

223. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013516 (Streptobacillus moniliformis DSM 12112 plasmid pSMON01, complete sequence) position: , mismatch: 7, identity: 0.781

attgttataattatttattgaaat--atcattcc	CRISPR spacer
tttatcataattatttattgaaattgataaat--	Protospacer
 **.*.******************  ** * *  

224. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027399 (Streptobacillus moniliformis strain FDAARGOS_310 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

attgttataattatttattgaaat--atcattcc	CRISPR spacer
tttatcataattatttattgaaattgataaat--	Protospacer
 **.*.******************  ** * *  

225. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to LN681534 (Clostridium phage phiCD24-1, complete genome) position: , mismatch: 7, identity: 0.781

-attgttataattatttattgaaatatcattcc	CRISPR spacer
ccctatta-aattatttattcaaatataattct	Protospacer
  .*.*** *********** ****** ****.

226. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN718463 (Clostridium phage phiCDKH01, complete genome) position: , mismatch: 7, identity: 0.781

-attgttataattatttattgaaatatcattcc	CRISPR spacer
ccctatta-aattatttattcaaatataattct	Protospacer
  .*.*** *********** ****** ****.

227. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgccagatgcgacgctggcgcgtcttatct	Protospacer
 . .*.*** ************************ 

228. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gtttatgccagatgcgacgctgacgcgtcttatct	Protospacer
 *. *.*** ************.*********** 

229. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
acggatgcccgatgcgacgctggcgcgtcttatcg	Protospacer
 . .*.***.************************.

230. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

231. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

232. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

233. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

234. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

235. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

236. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

237. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

238. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . .*.*******.********.************

239. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . .*.*******.********.************

240. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

241. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

242. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

243. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

244. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

245. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

246. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

247. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . .*.***************..************

248. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
acggatgctcgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.**..*************************

249. spacer 1.3|1026577|33|NZ_CP041452|PILER-CR,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

250. spacer 1.9|1026578|32|NZ_CP041452|CRISPRCasFinder matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
atgcggtcatggatgctgatgttgcagtgatg	Protospacer
*.*.********.***** ******** * ..

251. spacer 1.12|1026761|32|NZ_CP041452|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

252. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgcgcaaatcgagcgtgccgccggtgaggc	Protospacer
*********** **** *******..*    

253. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

254. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

255. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

256. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

257. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037738 (Citrobacter freundii strain CAV1857 plasmid pCAV1857-47, complete sequence) position: , mismatch: 8, identity: 0.75

attgttataattatttattgaaatatcattcc	CRISPR spacer
cccgagataatcagttattgaaatatcattca	Protospacer
 ..*  *****.* ***************** 

258. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF344556 (Enterobacter cloacae strain 30860 plasmid p30860-NR, complete sequence) position: , mismatch: 8, identity: 0.75

attgttataattatttattgaaatatcattcc	CRISPR spacer
cccgagataatcagttattgaaatatcattca	Protospacer
 ..*  *****.* ***************** 

259. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 8, identity: 0.75

attgttataattatttattgaaatatcattcc	CRISPR spacer
tatgttataattttttatggaaatatttttaa	Protospacer
  ********** ***** *******. **  

260. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023400 (Pseudoalteromonas spongiae strain SAO4-4 plasmid pl, complete sequence) position: , mismatch: 8, identity: 0.75

attgttataattatttattgaaatatcattcc	CRISPR spacer
tctgtagcaattatttatttaaataacattct	Protospacer
 .*** ..*********** ***** *****.

261. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK318083 (Aeromonas phage Akh-2, complete genome) position: , mismatch: 8, identity: 0.75

attgttataattatttattgaaatatcattcc	CRISPR spacer
gttgttataattacttgttgaaatcgccgttc	Protospacer
.************.**.*******  *  *.*

262. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

263. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

264. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

265. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

266. spacer 1.7|1026456|32|NZ_CP041452|CRISPRCasFinder matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gcaaaaaccgggcaatcgcaaaaaggcgtaat	CRISPR spacer
gaaaaaaccgcccaatcgcaaaaagatgacga	Protospacer
* ********  *************..*  . 

267. spacer 2.2|1047672|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN693721 (Marine virus AFVG_250M181, complete genome) position: , mismatch: 9, identity: 0.719

ccggtgcaactgatattgataaacgtcgactc	CRISPR spacer
tgggtggaactgatattgctaaacggagagaa	Protospacer
. **** *********** ******  **   

268. spacer 2.7|1047977|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaagctacttttgtgttcaactgatgcatt	CRISPR spacer
caatccgaccttttgtgttcgactgatggatt	Protospacer
 **      ***********.******* ***

269. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
tcttcggcatccagcgagccgccgtcgccca	Protospacer
.* .  . **************** ***.**

270. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gtcttcaagtcgagcgagccgccgacgccga	Protospacer
 . . ***.** ****************. *

271. spacer 2.8|1048038|31|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to AP014383 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
atgatgaaatccaacgagccgccgaggcttt	Protospacer
 .*   *******.*********** ***. 

272. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_015919 (Borreliella bissettii DN127 plasmid lp54, complete sequence) position: , mismatch: 9, identity: 0.719

attgttataattatttattgaaatatcattcc	CRISPR spacer
aattcgttaattatttttttaaatatcattat	Protospacer
* * .  ********* ** ********** .

273. spacer 8.1|3858772|35|NZ_CP041452|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 9, identity: 0.743

ttcaacgcctgatgcgacgctggcgcgtcttatca	CRISPR spacer
gcagatgcctgatgcgatgcttgcgcgtcttctta	Protospacer
 . .*.***********.*** ********* *.*

274. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tgattgccggatgcggcgtaaacgccttatccggccta	Protospacer
*...**.**********.**************..**..

275. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ctggtgccggatgcggcgtaaacgccttatccggccta	Protospacer
. * **.**********.**************..**..

276. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

277. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

278. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

279. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

280. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

281. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aaaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
 *. **.**********.**************..**..

282. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caagtgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

283. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caattgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*..**.**********.**************..**..

284. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttcttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

285. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
. .***.**********.**************. **..

286. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttatgccggatgcggcgtaaacgccttatccggccta	Protospacer
*   **.**********.**************..**..

287. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggccta	Protospacer
  *.**.**********.**************..**..

288. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

289. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cggttgccggatgcggcgtaaacgccttatccggccta	Protospacer
..*.**.**********.**************..**..

290. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
gacttgccggatgcggcgtaaacgccttatccggccac	Protospacer
 * .**.**********.**************..**  

291. spacer 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctccccaagtgccg	Protospacer
 *******.************ ***.   .. 

292. spacer 1.8|1026517|32|NZ_CP041452|CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctctccaagtgccg	Protospacer
 *******.************ ***.   .. 

293. spacer 2.1|1047611|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK613349 (Roseobacter phage CRP-7, complete genome) position: , mismatch: 10, identity: 0.688

gcagtaaattatttgacctcgttgataatccc	CRISPR spacer
cttagatataatttgccctcgttgataatcaa	Protospacer
 . . * ** ***** **************  

294. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

295. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to KJ094025 (Listeria phage LP-032 contig 2, partial genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

296. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

297. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

298. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

299. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

300. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

301. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

302. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

303. spacer 2.4|1047794|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 10, identity: 0.688

tgtatcaccgaaagaatggtttgacgcgcagg	CRISPR spacer
ggtatgaccgaaagaatgatttgattgcttgt	Protospacer
 **** ************.*****.   . * 

304. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

305. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

306. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

307. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

308. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

309. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

310. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

311. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

312. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

313. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

314. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

315. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

316. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

317. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

318. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

319. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

320. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

321. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

322. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

323. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

324. spacer 2.9|1048098|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

325. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_016942 (Staphylococcus argenteus MSHR1132 plasmid pST75 complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

326. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029750 (Staphylococcus aureus strain Smith plasmid pSS41, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

327. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030488 (Staphylococcus aureus strain ER01009.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

328. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030517 (Staphylococcus aureus strain ER01116.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

329. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030707 (Staphylococcus aureus strain ER03493.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

330. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053186 (Staphylococcus aureus strain Guangzhou-SAU749 plasmid pSAU749, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

331. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016857 (Staphylococcus aureus subsp. aureus strain 1971.C01 plasmid p1971.C01c, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

332. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053184 (Staphylococcus aureus strain Guangzhou-SAU071 plasmid pSAU071, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

333. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030633 (Staphylococcus aureus strain ER03755.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

334. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

335. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

336. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

337. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

338. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013230 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_4, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

339. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030325 (Staphylococcus aureus strain AR_474 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

340. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018956 (Staphylococcus aureus plasmid p18806-P03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

341. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018767 (Staphylococcus aureus subsp. aureus strain UCI62 plasmid pUCI62, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

342. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030383 (Staphylococcus aureus strain ER03761.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

343. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030587 (Staphylococcus aureus strain ER00594.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

344. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030607 (Staphylococcus aureus strain ER02693.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

345. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030663 (Staphylococcus aureus strain ER03489.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

346. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039449 (Staphylococcus aureus strain VGC1 plasmid pVGC1_1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

347. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030385 (Staphylococcus aureus strain ER00959.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

348. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030530 (Staphylococcus aureus strain ER04421.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

349. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014408 (Staphylococcus aureus strain USA300-SUR12 plasmid pUSA04-1-SUR12, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

350. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014411 (Staphylococcus aureus strain USA300-SUR13 plasmid pUSA04-1-SUR13, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

351. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014367 (Staphylococcus aureus strain USA300-SUR2 plasmid pUSA04-1-SUR2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

352. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054441 (Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

353. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to LC383633 (Staphylococcus aureus SI1 plasmid pWSI1 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

354. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031889 (Staphylococcus aureus strain CFSAN082782 plasmid pMRSA_23, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

355. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030387 (Staphylococcus aureus strain ER01062.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

356. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030513 (Staphylococcus aureus strain ER01817.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

357. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030666 (Staphylococcus aureus strain ER01454.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

358. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014386 (Staphylococcus aureus strain USA300-SUR7 plasmid pUSA04-3-SUR7, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

359. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030397 (Staphylococcus aureus strain ER01719.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

360. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030414 (Staphylococcus aureus strain ER03113.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

361. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011527 (Staphylococcus aureus subsp. aureus DSM 20231 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

362. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030497 (Staphylococcus aureus strain ER02658.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

363. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013956 (Staphylococcus aureus strain NCCP14562 isolate Sequencing plasmid pNCCP14562, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

364. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_003140 (Staphylococcus aureus subsp. aureus N315 plasmid pN315, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

365. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016862 (Staphylococcus aureus subsp. aureus strain 1625.C01 plasmid p1625.C01, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

366. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_010419 (Staphylococcus aureus plasmid pTZ2162, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

367. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013954 (Staphylococcus aureus strain NCCP14558 plasmid pNCCP14558, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

368. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030416 (Staphylococcus aureus strain ER01836.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

369. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030477 (Staphylococcus aureus strain ER04436.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

370. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030521 (Staphylococcus aureus strain ER01564.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

371. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012975 (Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

372. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR130519 (Staphylococcus aureus strain BPH2986 isolate BPH2986 plasmid 2) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

373. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020323 (Staphylococcus aureus strain KUH180129 plasmid p01KUH180129, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

374. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030444 (Staphylococcus aureus strain ER01838.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

375. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030533 (Staphylococcus aureus strain ER02495.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

376. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014434 (Staphylococcus aureus strain USA300-SUR20 plasmid pUSA04-1-SUR20, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

377. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_010077 (Staphylococcus aureus plasmid EDINA, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

378. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030466 (Staphylococcus aureus strain ER04235.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

379. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030555 (Staphylococcus aureus strain PS00003.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

380. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011529 (Staphylococcus aureus strain RKI4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

381. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013289 (Staphylococcus aureus plasmid SAP015A, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

382. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013292 (Staphylococcus aureus plasmid pWBG752, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

383. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013294 (Staphylococcus aureus plasmid SAP046A, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

384. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013296 (Staphylococcus aureus plasmid SAP049A, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

385. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013298 (Staphylococcus aureus plasmid SAP050A, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

386. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013299 (Staphylococcus aureus plasmid SAP051A, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

387. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018952 (Staphylococcus aureus plasmid pWBG747, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

388. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029677 (Staphylococcus aureus strain AR_0216 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

389. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035102 (Staphylococcus aureus subsp. aureus strain ATCC 12600 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

390. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029199 (Staphylococcus aureus strain aureus plasmid pFORC_090.1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

391. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030523 (Staphylococcus aureus strain ER04163.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

392. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030616 (Staphylococcus aureus strain ER01560.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

393. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to LC377540 (Staphylococcus aureus plasmid pNTUH_5066148 NTUH_5066148 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

394. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_019150 (Staphylococcus aureus plasmid p18805-P03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

395. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_019148 (Staphylococcus aureus PM1 plasmid pPM1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

396. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030442 (Staphylococcus aureus strain ER04385.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

397. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030494 (Staphylococcus aureus strain ER03857.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

398. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030698 (Staphylococcus aureus strain ER01334.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

399. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014063 (Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

400. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007679 (Staphylococcus aureus strain HUV05 plasmid pHUV05-03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

401. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030324 (Staphylococcus aureus strain AR_475 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

402. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933272 (Staphylococcus aureus subsp. aureus plasmid p4456, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

403. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933273 (Staphylococcus aureus subsp. aureus plasmid p6092, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

404. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933274 (Staphylococcus aureus subsp. aureus plasmid p6306, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

405. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933275 (Staphylococcus aureus subsp. aureus plasmid p6414-1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

406. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933276 (Staphylococcus aureus subsp. aureus plasmid p6530, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

407. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017095 (Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.C01b, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

408. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_005127 (Staphylococcus aureus plasmid pUB101, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

409. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933268 (Staphylococcus aureus subsp. aureus plasmid p4578, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

410. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933269 (Staphylococcus aureus subsp. aureus plasmid p2-1850, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

411. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933270 (Staphylococcus aureus subsp. aureus plasmid p1070, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

412. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MK933271 (Staphylococcus aureus subsp. aureus plasmid p2575, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

413. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020314 (Staphylococcus aureus strain KUH140046 plasmid p01KUH140046, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

414. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012118 (Staphylococcus aureus subsp. aureus strain USA300_2014.C01 plasmid pC01, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

415. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030571 (Staphylococcus aureus strain ER01892.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

416. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030567 (Staphylococcus aureus strain ER04242.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

417. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030461 (Staphylococcus aureus strain ER04013.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

418. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030535 (Staphylococcus aureus strain ER00749.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

419. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030643 (Staphylococcus aureus strain ER00385.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

420. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030669 (Staphylococcus aureus strain ER00951.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

421. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030623 (Staphylococcus aureus strain ER01524.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

422. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013322 (Staphylococcus aureus plasmid SAP019A, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

423. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013324 (Staphylococcus aureus plasmid SAP027A, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

424. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013326 (Staphylococcus aureus plasmid pWBG746, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

425. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013330 (Staphylococcus aureus plasmid pWBG759, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

426. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013332 (Staphylococcus aureus plasmid SAP052A, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

427. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013348 (Staphylococcus aureus plasmid pSK156, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

428. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030463 (Staphylococcus aureus strain ER00695.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

429. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030697 (Staphylococcus aureus strain ER01532.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

430. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_023278 (Staphylococcus aureus strain SA268 plasmid pSA268, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

431. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP040802 (Staphylococcus aureus strain S15 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

432. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030446 (Staphylococcus aureus strain ER04127.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

433. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030536 (Staphylococcus aureus strain ER02094.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

434. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030660 (Staphylococcus aureus strain ER02217.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

435. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025250 (Staphylococcus argenteus strain XNO106 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

436. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030539 (Staphylococcus aureus strain ER01935.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

437. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030690 (Staphylococcus aureus strain ER01507.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

438. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047853 (Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

439. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047848 (Staphylococcus aureus strain UP_522 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

440. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009362 (Staphylococcus aureus subsp. aureus strain ATCC 25923 plasmid pS1945, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

441. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007177 (Staphylococcus aureus USA300-ISMMS1 plasmid pUSA01-ISMMS, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

442. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029079 (Staphylococcus aureus strain AR466 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

443. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_007931 (Staphylococcus aureus plasmid pSA1379, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

444. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018957 (Staphylococcus aureus plasmid p18807-P03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

445. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018959 (Staphylococcus aureus plasmid p18808-P03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

446. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018961 (Staphylococcus aureus plasmid p18809-P03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

447. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018963 (Staphylococcus aureus plasmid p18810-P03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

448. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018974 (Staphylococcus aureus plasmid p18811-P03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

449. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030700 (Staphylococcus aureus strain ER03023.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

450. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014394 (Staphylococcus aureus strain USA300-SUR9 plasmid pUSA04-2-SUR9, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

451. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020325 (Staphylococcus aureus strain KUN1163 plasmid p01KUN1163, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

452. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020319 (Staphylococcus aureus strain KUH180038 plasmid p01KUH180038, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

453. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014414 (Staphylococcus aureus strain USA300-SUR14 plasmid pUSA04-1-SUR14, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

454. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

455. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

456. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030672 (Staphylococcus aureus strain pt053 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

457. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030433 (Staphylococcus aureus strain ER00610.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

458. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030528 (Staphylococcus aureus strain ER02703.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

459. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030625 (Staphylococcus aureus strain ER03448.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

460. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030644 (Staphylococcus aureus strain ER03298.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

461. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047831 (Staphylococcus aureus strain UP_996 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

462. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047836 (Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

463. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048646 (Staphylococcus aureus strain SR153 plasmid pSR03, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

464. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030436 (Staphylococcus aureus strain ER04086.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

465. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019544 (Staphylococcus aureus strain KG-18 plasmid pKG-18, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

466. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019546 (Staphylococcus aureus strain KG-22 plasmid pKG-22, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

467. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013550 (Staphylococcus aureus plasmid pBORa53, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

468. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030629 (Staphylococcus aureus strain ER03809.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

469. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030597 (Staphylococcus aureus strain ER02443.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

470. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030662 (Staphylococcus aureus strain ER02826.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

471. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

472. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

473. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

474. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

475. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053635 (Staphylococcus aureus strain 14638 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

476. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030676 (Staphylococcus aureus strain ER01533.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

477. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020021 (Staphylococcus aureus subsp. aureus strain ATCC 6538 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

478. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MN909556 (Staphylococcus saprophyticus strain 1005578 plasmid p1005578_vga, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

479. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030425 (Staphylococcus aureus strain ER00551.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

480. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030602 (Staphylococcus aureus strain ER00658.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

481. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030598 (Staphylococcus aureus strain ER02524.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

482. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020312 (Staphylococcus aureus strain KUH140013 plasmid p01KUH140013, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

483. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020321 (Staphylococcus aureus strain KUH180062 plasmid p01KUH180062, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

484. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030427 (Staphylococcus aureus strain ER04320.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

485. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

486. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014943 (Staphylococcus aureus strain FDA209P plasmid pFDA209P, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

487. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030576 (Staphylococcus aureus strain ER03910.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

488. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030649 (Staphylococcus aureus strain ER03556.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

489. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047857 (Staphylococcus aureus strain UP_1435 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

490. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053637 (Staphylococcus aureus strain 14640 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

491. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031887 (Staphylococcus aureus strain CFSAN082783 plasmid pMRSA_24, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

492. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030408 (Staphylococcus aureus strain PS00002.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

493. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030578 (Staphylococcus aureus strain ER01881.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

494. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030694 (Staphylococcus aureus strain ER01803.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

495. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040999 (Staphylococcus aureus strain FDAARGOS_773 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

496. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047842 (Staphylococcus aureus strain UP_644 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

497. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014922 (Staphylococcus aureus strain JH4899 plasmid pJSA01, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

498. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030560 (Staphylococcus aureus strain ER01457.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

499. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030714 (Staphylococcus aureus strain ER02878.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

500. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029666 (Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

501. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014404 (Staphylococcus aureus strain USA300-SUR11 plasmid pUSA04-2-SUR11, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

502. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030485 (Staphylococcus aureus strain ER03913.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

503. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021906 (Staphylococcus aureus strain Seattle 1945 isolate G477 plasmid pG477, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

504. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029665 (Staphylococcus aureus strain AR_0226 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

505. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016854 (Staphylococcus aureus subsp. aureus strain 5118.N plasmid p5118.Nb, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

506. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030376 (Staphylococcus aureus strain ER04041.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

507. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030563 (Staphylococcus aureus strain ER03720.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

508. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030680 (Staphylococcus aureus strain ER00573.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

509. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_017345 (Staphylococcus aureus subsp. aureus TCH60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

510. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030509 (Staphylococcus aureus strain ER00707.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

511. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030584 (Staphylococcus aureus strain ER02262.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

512. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_009619 (Staphylococcus aureus subsp. aureus JH1 plasmid pSJH101, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

513. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044105 (Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

514. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030401 (Staphylococcus aureus strain ER02637.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

515. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030409 (Staphylococcus aureus strain ER03996.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

516. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030473 (Staphylococcus aureus strain ER00767.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

517. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030549 (Staphylococcus aureus strain ER03928.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

518. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043303 (Staphylococcus aureus strain 16445 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

519. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039996 (Staphylococcus aureus subsp. aureus M013 plasmid pM013, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

520. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014364 (Staphylococcus aureus strain USA300-SUR1 plasmid pUSA04-1-SUR1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

521. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054445 (Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

522. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040621 (Staphylococcus aureus strain J01 plasmid pJ01-02, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

523. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053638 (Staphylococcus aureus strain 14732 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

524. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030593 (Staphylococcus aureus strain ER02989.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

525. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030511 (Staphylococcus aureus strain ER04636.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

526. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_010063 (Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

527. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH068822 (Staphylococcus argenteus strain XNO62 plasmid pXNO62, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

528. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH587574 (Staphylococcus aureus strain WBG10514 plasmid pWBG731, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

529. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH785258 (Staphylococcus aureus strain ph1 plasmid pPH1-2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

530. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042047 (Staphylococcus aureus strain B2-7A plasmid pSALNBL75, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

531. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030405 (Staphylococcus aureus strain ER04219.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

532. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030565 (Staphylococcus aureus strain ER01989.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

533. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022608 (Staphylococcus aureus strain FORC_061 plasmid pFORC61_2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

534. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_021552 (Staphylococcus aureus CA-347 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

535. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031891 (Staphylococcus aureus strain CFSAN082781 plasmid pMRSA_22, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

536. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NC_009477 (Staphylococcus aureus subsp. aureus JH9 plasmid pSJH901, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

537. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030519 (Staphylococcus aureus strain ER04332.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

538. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to CP030657 (Staphylococcus aureus strain ER04448.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatatgattat	Protospacer
* .    ************.****** *** .

539. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045473 (Staphylococcus aureus strain ZY05 plasmid pZY05, complete sequence) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
aactaactaattatttattaaaatataattat	Protospacer
* .    ************.****** *** .

540. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MG757166 (Gordonia phage SuperSulley, complete genome) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
tctcacataattattcattcaaatatcatcat	Protospacer
 .*  .*********.*** *********. .

541. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MF919510 (Gordonia phage Kabluna, complete genome) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
tctcacataattattcattcaaatatcatcat	Protospacer
 .*  .*********.*** *********. .

542. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MH598798 (Pelagibacter phage HTVC022P, complete genome) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
gcgttcttaattatttattgaagtatcttttt	Protospacer
..  *. ***************.**** **..

543. spacer 2.10|1048159|32|NZ_CP041452|PILER-CR,CRISPRCasFinder,CRT matches to MH779499 (Gordonia phage Buggaboo, complete genome) position: , mismatch: 10, identity: 0.688

attgttataattatttattgaaatatcattcc	CRISPR spacer
tctcacataattattcattcaaatatcatcat	Protospacer
 .*  .*********.*** *********. .

544. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccattgccggatgcggcgtaaacgccttatccggccta	Protospacer
. ..**.**********.**************..**..

545. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aggttgccggatgcggcgtaaacgccttatccggcata	Protospacer
 .*.**.**********.**************..* ..

546. spacer 9.1|3890748|38|NZ_CP041452|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatctggccta	Protospacer
.*. **.**********.*************...**..

547. spacer 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   .. 

548. spacer 1.2|1026516|33|NZ_CP041452|PILER-CR,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1055767 : 1068950 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 1149991 : 1250455 103 Cronobacter_phage(45.83%) terminase,head,capsid,integrase,holin,transposase,portal,tail,tRNA attL 1169591:1169607|attR 1239303:1239319
DBSCAN-SWA_3 1463033 : 1475058 15 Enterobacteria_phage(57.14%) integrase,plate attL 1459925:1459941|attR 1477068:1477084
DBSCAN-SWA_4 1715021 : 1724462 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 1816693 : 1824660 8 Klebsiella_phage(16.67%) NA NA
DBSCAN-SWA_6 1893714 : 1903635 12 Burkholderia_phage(33.33%) transposase NA
DBSCAN-SWA_7 2284005 : 2299810 15 Salmonella_phage(25.0%) integrase attL 2281709:2281722|attR 2294074:2294087
DBSCAN-SWA_8 3542066 : 3607804 70 Enterobacteria_phage(48.65%) holin,lysis,integrase,tail attL 3570978:3570996|attR 3592188:3592206
DBSCAN-SWA_9 3616938 : 3660378 63 Shigella_phage(55.17%) terminase,head,capsid,integrase,tail,protease,holin,lysis,portal,plate attL 3614805:3614852|attR 3656475:3656522
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP041451
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 24507 26 Salmonella_phage(87.5%) integrase attL 12839:12858|attR 21555:21574
DBSCAN-SWA_2 31286 : 42419 15 Salmonella_phage(75.0%) NA NA
DBSCAN-SWA_3 46427 : 114001 72 Salmonella_phage(87.3%) tail,tRNA,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP041453
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041453_1 54126-54245 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 0 1.0
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 1 0.971
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP022061 Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence 1711-1744 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 CP048927 Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence 45611-45644 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 98434-98467 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP028313 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence 41569-41602 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP018662 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence 41992-42025 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 CP049987 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence 41386-41419 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 CP049982 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence 42740-42773 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NC_010421 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence 27662-27695 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_MK625201 Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence 41824-41857 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP023476 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence 33473-33506 2 0.941
NZ_CP041453_1 1.1|54169|34|NZ_CP041453|CRISPRCasFinder 54169-54202 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 4 0.882

1. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

2. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

3. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

4. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

5. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

6. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

7. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

8. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

9. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

10. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

11. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

12. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

13. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

14. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

15. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

16. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

17. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

18. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

19. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

20. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

21. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

22. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

23. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

24. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

25. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

26. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

27. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

28. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

29. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

30. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

31. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

32. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

33. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

34. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

35. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

36. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

37. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

38. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

39. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

40. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

41. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

42. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

43. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

44. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

45. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

46. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

47. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

48. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

49. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

50. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

51. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

52. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

53. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

54. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

55. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

56. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

57. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

58. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

59. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

60. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

61. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

62. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

63. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

64. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

65. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

66. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

67. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

68. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

69. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

70. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

71. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

72. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

73. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

74. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

75. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

76. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

77. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

78. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

79. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

80. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

81. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

82. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

83. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

84. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

85. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

86. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

87. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

88. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

89. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

90. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

91. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

92. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

93. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

94. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

95. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

96. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

97. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

98. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

99. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

100. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

101. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

102. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

103. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

104. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

105. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

106. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

107. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

108. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

109. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

110. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

111. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

112. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

113. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

114. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

115. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

116. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

117. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

118. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

119. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

120. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

121. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

122. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

123. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

124. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

125. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

126. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

127. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

128. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

129. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

130. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

131. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

132. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

133. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

134. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

135. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

136. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

137. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

138. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

139. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

140. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

141. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

142. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

143. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

144. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

145. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

146. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

147. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

148. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

149. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

150. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

151. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

152. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

153. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

154. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

155. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

156. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

157. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

158. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

159. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

160. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

161. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

162. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

163. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

164. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

165. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

166. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

167. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 1, identity: 0.971

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaatcacag	Protospacer
*****************************.****

168. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gcccgcagccatccacctttcatgaaaattacag	Protospacer
*. *******************************

169. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gcccgcagccatccacctttcatgaaaattacag	Protospacer
*. *******************************

170. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP022061 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

171. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to CP048927 (Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

172. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

173. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP028313 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

174. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP018662 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

175. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to CP049987 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

176. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to CP049982 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

177. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NC_010421 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

178. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_MK625201 (Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

179. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP023476 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

180. spacer 1.1|54169|34|NZ_CP041453|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 4, identity: 0.882

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
tcgaacagccatccacctttcatgaaaattacag	Protospacer
 .* .*****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1249 : 57764 57 Escherichia_phage(27.27%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage