Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031739 Psychrobacillus sp. AK 1817 chromosome, complete genome 3 crisprs RT,WYL,DinG,cas3,DEDDh,csa3 0 1 4 0

Results visualization

1. NZ_CP031739
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031739_1 183402-183495 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031739_2 848819-848895 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031739_3 1416117-1416224 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031739_2 2.1|848842|31|NZ_CP031739|CRISPRCasFinder 848842-848872 31 NZ_CP034564 Flammeovirga pectinis strain L12M1 plasmid unnamed1, complete sequence 28792-28822 7 0.774
NZ_CP031739_2 2.1|848842|31|NZ_CP031739|CRISPRCasFinder 848842-848872 31 MN694380 Marine virus AFVG_250M409, complete genome 25861-25891 8 0.742

1. spacer 2.1|848842|31|NZ_CP031739|CRISPRCasFinder matches to NZ_CP034564 (Flammeovirga pectinis strain L12M1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcctccaaatttatttattcgccatttat	CRISPR spacer
tttacatgaaatttatttatccaccatttat	Protospacer
**  * . ************.*.********

2. spacer 2.1|848842|31|NZ_CP031739|CRISPRCasFinder matches to MN694380 (Marine virus AFVG_250M409, complete genome) position: , mismatch: 8, identity: 0.742

ttgcctccaaatttatttattcgccatttat	CRISPR spacer
cagcagtaaaatttattttttcgccatttac	Protospacer
. **  . ********** ***********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 794445 : 798263 8 uncultured_Caudovirales_phage(33.33%) holin NA
DBSCAN-SWA_2 2301856 : 2310406 9 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 2734890 : 2761314 22 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_4 3242204 : 3250449 8 Synechococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage