Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044256 Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence 0 crisprs csa3 0 0 14 0
NZ_CP044257 Salmonella enterica strain CFSAN096147 chromosome, complete genome 2 crisprs PD-DExK,WYL,csa3,cas3,DEDDh,DinG,RT 1 13 5 0

Results visualization

1. NZ_CP044256
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1037 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_2 6255 : 7311 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_3 12909 : 21629 8 Salmonella_phage(80.0%) NA NA
DBSCAN-SWA_4 37477 : 38482 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_5 41587 : 42625 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_6 57307 : 59092 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_7 78824 : 121316 42 Escherichia_phage(25.0%) protease,integrase,transposase attL 77127:77140|attR 95039:95052
DBSCAN-SWA_8 126223 : 166746 44 Escherichia_phage(27.27%) transposase,integrase attL 143629:143682|attR 143950:144003
DBSCAN-SWA_9 170118 : 177375 5 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_10 182469 : 184547 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_11 191306 : 193464 2 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_12 205141 : 206819 2 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_13 230528 : 284066 66 uncultured_Caudovirales_phage(26.67%) transposase NA
DBSCAN-SWA_14 288521 : 288953 1 Salmonella_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP044257
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044257_1 895907-897217 Orphan I-E
21 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044257_2 906980-907679 Orphan I-E
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP044257_1 1.4|896120|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896120-896151 32 NZ_CP044257.1 1398642-1398673 1 0.969

1. spacer 1.4|896120|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to position: 1398642-1398673, mismatch: 1, identity: 0.969

gcagattggtatctggtacgacgactgccgcc	CRISPR spacer
gcagattggtatccggtacgacgactgccgcc	Protospacer
*************.******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044257_2 2.10|907557|33|NZ_CP044257|PILER-CR 907557-907589 33 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 35344-35376 0 1.0
NZ_CP044257_2 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT 907558-907589 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 35345-35376 0 1.0
NZ_CP044257_2 2.10|907557|33|NZ_CP044257|PILER-CR 907557-907589 33 NZ_CP029990 Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence 95163-95195 1 0.97
NZ_CP044257_2 2.10|907557|33|NZ_CP044257|PILER-CR 907557-907589 33 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 9402-9434 1 0.97
NZ_CP044257_2 2.10|907557|33|NZ_CP044257|PILER-CR 907557-907589 33 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 39737-39769 1 0.97
NZ_CP044257_2 2.10|907557|33|NZ_CP044257|PILER-CR 907557-907589 33 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 113375-113407 1 0.97
NZ_CP044257_2 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT 907558-907589 32 NZ_CP029990 Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence 95164-95195 1 0.969
NZ_CP044257_2 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT 907558-907589 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 9403-9434 1 0.969
NZ_CP044257_2 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT 907558-907589 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 39737-39768 1 0.969
NZ_CP044257_2 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT 907558-907589 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 113376-113407 1 0.969
NZ_CP044257_1 1.11|896547|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896547-896578 32 NZ_CP009113 Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence 57554-57585 6 0.812
NZ_CP044257_2 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT 907558-907589 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 270963-270994 7 0.781
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 189898-189929 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 189898-189929 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1789627-1789658 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1806317-1806348 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 51148-51179 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 212687-212718 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 382523-382554 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 212685-212716 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1769551-1769582 8 0.75
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 MN536027 Pseudomonas phage vB_Pae-SS2019XII, complete genome 14176-14207 8 0.75
NZ_CP044257_1 1.19|897035|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 897035-897066 32 MH622910 Caudovirales sp. isolate ctdb_3, complete genome 4473-4504 8 0.75
NZ_CP044257_1 1.5|896181|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896181-896212 32 NZ_CP014361 Methylomonas sp. DH-1 plasmid, complete sequence 141473-141504 9 0.719
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 276209-276240 9 0.719
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 20088-20119 9 0.719
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP049813 Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence 69714-69745 9 0.719
NZ_CP044257_1 1.11|896547|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896547-896578 32 MN096355 Mycobacterium phage Purky, complete genome 25716-25747 9 0.719
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 MN694197 Marine virus AFVG_250M303, complete genome 6755-6786 9 0.719
NZ_CP044257_2 2.7|907374|33|NZ_CP044257|PILER-CR 907374-907406 33 NZ_CP021643 Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence 63579-63611 9 0.727
NZ_CP044257_2 2.13|907070|32|NZ_CP044257|CRISPRCasFinder,CRT 907070-907101 32 AP018321 Nostoc sp. HK-01 plasmid plasmid3 DNA, complete genome 46531-46562 9 0.719
NZ_CP044257_2 2.18|907375|32|NZ_CP044257|CRISPRCasFinder,CRT 907375-907406 32 NZ_CP021643 Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence 63580-63611 9 0.719
NZ_CP044257_2 2.18|907375|32|NZ_CP044257|CRISPRCasFinder,CRT 907375-907406 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2378875-2378906 9 0.719
NZ_CP044257_1 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896303-896334 32 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 171558-171589 10 0.688
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 KX119175 Helicobacter phage Pt22899G, complete genome 5088-5119 10 0.688
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 KX119175 Helicobacter phage Pt22899G, complete genome 16950-16981 10 0.688
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 JF734911 Helicobacter phage phiHP33, complete genome 19807-19838 10 0.688
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 KX119200 Helicobacter phage FrMEG235U, complete genome 14594-14625 10 0.688
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 KX119200 Helicobacter phage FrMEG235U, complete genome 19690-19721 10 0.688
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 KX119201 Helicobacter phage FrANT170U, complete genome 14594-14625 10 0.688
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 KX119201 Helicobacter phage FrANT170U, complete genome 19690-19721 10 0.688
NZ_CP044257_1 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896608-896639 32 KX119179 Helicobacter phage Pt5303G mobile element protein and transposase genes, complete cds 1261-1292 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP031899 Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence 76272-76303 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 141990-142021 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP009107 Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence 141989-142020 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP028382 Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence 155197-155228 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP027343 Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence 103401-103432 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP027311 Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence 50904-50935 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 97903-97934 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP027585 Escherichia coli strain 00-3076 plasmid unnamed, complete sequence 13352-13383 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP027370 Escherichia coli strain 2014C-3307 plasmid unnamed2 109572-109603 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP027453 Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence 79387-79418 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP027451 Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence 10648-10679 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP027372 Escherichia coli strain 2015C-3905 plasmid unnamed 102888-102919 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP028121 Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence 49990-50021 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NC_007365 Escherichia coli EH41 plasmid pO113, complete sequence 160071-160102 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP023542 Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence 141994-142025 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP010192 Escherichia coli strain M8 plasmid A, complete genome 74522-74553 10 0.688
NZ_CP044257_1 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896730-896761 32 NZ_CP023164 Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence 35202-35233 10 0.688
NZ_CP044257_1 1.19|897035|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 897035-897066 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1409535-1409566 10 0.688
NZ_CP044257_2 2.7|907374|33|NZ_CP044257|PILER-CR 907374-907406 33 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2378874-2378906 10 0.697
NZ_CP044257_2 2.13|907070|32|NZ_CP044257|CRISPRCasFinder,CRT 907070-907101 32 MG592456 Vibrio phage 1.081.O._10N.286.52.C2, partial genome 229928-229959 10 0.688
NZ_CP044257_2 2.19|907436|32|NZ_CP044257|CRISPRCasFinder,CRT 907436-907467 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 318607-318638 10 0.688
NZ_CP044257_1 1.15|896791|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT 896791-896822 32 NZ_CP015094 Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence 53594-53625 11 0.656

1. spacer 2.10|907557|33|NZ_CP044257|PILER-CR matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatatccgcccatcggcc	Protospacer
*********************************

2. spacer 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatatccgcccatcggcc	Protospacer
********************************

3. spacer 2.10|907557|33|NZ_CP044257|PILER-CR matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 1, identity: 0.97

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatattcgcccatcggcc	Protospacer
********************.************

4. spacer 2.10|907557|33|NZ_CP044257|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatattcgcccatcggcc	Protospacer
********************.************

5. spacer 2.10|907557|33|NZ_CP044257|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatattcgcccatcggcc	Protospacer
********************.************

6. spacer 2.10|907557|33|NZ_CP044257|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatattcgcccatcggcc	Protospacer
********************.************

7. spacer 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

8. spacer 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

9. spacer 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

10. spacer 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

11. spacer 1.11|896547|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009113 (Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence) position: , mismatch: 6, identity: 0.812

gcgctgaccatgattgcagtcagg--gtcggcat	CRISPR spacer
tcgctgaccatgattgcagccgggtcgtcggg--	Protospacer
 ******************.*.**  *****   

12. spacer 2.21|907558|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgagaaacgcctggatctccgcccaccgccg	Protospacer
*** . *********** ********.** * 

13. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc--	CRISPR spacer
cgcgggcgctcgacgcgctgcac--gtggccctg	Protospacer
***.****** ************  ...*.**  

14. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc--	CRISPR spacer
cgcgggcgctcgacgcgctgcac--gtggccctg	Protospacer
***.****** ************  ...*.**  

15. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

16. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

17. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc--	CRISPR spacer
cgcgggcgctcgacgcgctgcac--gtggccctg	Protospacer
***.****** ************  ...*.**  

18. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

19. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc----	CRISPR spacer
cgcaggcgctggccgagctgc----acgatccagag	Protospacer
************ ** *****    **..***    

20. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

21. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

22. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to MN536027 (Pseudomonas phage vB_Pae-SS2019XII, complete genome) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
tccaggcgctggaggcgctgcgcagcaagagc	Protospacer
. *********** *******.***  **  *

23. spacer 1.19|897035|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to MH622910 (Caudovirales sp. isolate ctdb_3, complete genome) position: , mismatch: 8, identity: 0.75

---aaacaccaacattacggcacgcaagaggttat	CRISPR spacer
ttcaagcgtcag---tacggcacgcaagaagttat	Protospacer
   **.*..**.   **************.*****

24. spacer 1.5|896181|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014361 (Methylomonas sp. DH-1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

actgttaaaatgcttcaggacggtgaagtaaa	CRISPR spacer
caagcgaaaatgcttcaggatggtgaaatatg	Protospacer
   *. **************.******.** .

25. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcgggcgctggacgcgccgcacaagaccttt	Protospacer
***.**************.*****..   *..

26. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 9, identity: 0.719

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcaggcgctggagacgctgcacgatcgaaca	Protospacer
************* .********.. *.. * 

27. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
tgcaggccctgaacgcgctgcacatctatcac	Protospacer
.****** ***.************  .* . *

28. spacer 1.11|896547|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 9, identity: 0.719

gcgctgaccatgattgcagtcagggtcggcat	CRISPR spacer
ctggctgccatgatcgcagtcatggtcggcct	Protospacer
 .* . .*******.******* ******* *

29. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to MN694197 (Marine virus AFVG_250M303, complete genome) position: , mismatch: 9, identity: 0.719

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
aatagggaatgaaacgtattagtaaaaacaaa	Protospacer
.. ... .******** ***************

30. spacer 2.7|907374|33|NZ_CP044257|PILER-CR matches to NZ_CP021643 (Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence) position: , mismatch: 9, identity: 0.727

gaaaccagaattgctgaagtaaattgcaaaaga	CRISPR spacer
gaaacaagatttgctgaagtaaatttagcattt	Protospacer
***** *** ***************  . *   

31. spacer 2.13|907070|32|NZ_CP044257|CRISPRCasFinder,CRT matches to AP018321 (Nostoc sp. HK-01 plasmid plasmid3 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcgttctacagtaaggtttacagcctgagcaa	CRISPR spacer
tgcctattcagtaagggttacagccttagcat	Protospacer
   .* * ******** ********* **** 

32. spacer 2.18|907375|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP021643 (Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence) position: , mismatch: 9, identity: 0.719

aaaccagaattgctgaagtaaattgcaaaaga	CRISPR spacer
aaacaagatttgctgaagtaaatttagcattt	Protospacer
**** *** ***************  . *   

33. spacer 2.18|907375|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

aaaccagaattgctgaagtaaattgcaaaaga	CRISPR spacer
acgggcgaattgctgaaggaaatcgcaaaaat	Protospacer
* .   ************ ****.******. 

34. spacer 1.7|896303|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
gtcaggcgctgcacgccctgcacagccgcgag	Protospacer
  ********* **** ******** *.    

35. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to KX119175 (Helicobacter phage Pt22899G, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

36. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to KX119175 (Helicobacter phage Pt22899G, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

37. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to JF734911 (Helicobacter phage phiHP33, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

38. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to KX119200 (Helicobacter phage FrMEG235U, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

39. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to KX119200 (Helicobacter phage FrMEG235U, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

40. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to KX119201 (Helicobacter phage FrANT170U, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

41. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to KX119201 (Helicobacter phage FrANT170U, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

42. spacer 1.12|896608|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to KX119179 (Helicobacter phage Pt5303G mobile element protein and transposase genes, complete cds) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

43. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031899 (Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

44. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

45. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

46. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028382 (Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

47. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027343 (Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

48. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027311 (Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

49. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

50. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027585 (Escherichia coli strain 00-3076 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

51. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027370 (Escherichia coli strain 2014C-3307 plasmid unnamed2) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

52. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027453 (Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

53. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027451 (Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

54. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

55. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028121 (Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

56. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NC_007365 (Escherichia coli EH41 plasmid pO113, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

57. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023542 (Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

58. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010192 (Escherichia coli strain M8 plasmid A, complete genome) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

59. spacer 1.14|896730|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023164 (Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

60. spacer 1.19|897035|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aaacaccaacattacggcacgcaagaggttat	CRISPR spacer
gctcaccgacattacggcgcgcaagaaggcgg	Protospacer
.  ****.**********.*******.* .. 

61. spacer 2.7|907374|33|NZ_CP044257|PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697

gaaaccagaattgctgaagtaaattgcaaaaga	CRISPR spacer
aacgggcgaattgctgaaggaaatcgcaaaaat	Protospacer
.* .   ************ ****.******. 

62. spacer 2.13|907070|32|NZ_CP044257|CRISPRCasFinder,CRT matches to MG592456 (Vibrio phage 1.081.O._10N.286.52.C2, partial genome) position: , mismatch: 10, identity: 0.688

gcgttctacagtaaggtttacagcctgagcaa	CRISPR spacer
gaacggctgagtaacgttaacagcctgagcaa	Protospacer
* ..  .  ***** *** *************

63. spacer 2.19|907436|32|NZ_CP044257|CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 10, identity: 0.688

atatcgaacgggttacggctgtcggtgtaact	CRISPR spacer
tgaccgaccgggtaacggctgtcggtggcgac	Protospacer
  *.*** ***** *************  . .

64. spacer 1.15|896791|32|NZ_CP044257|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 11, identity: 0.656

ccagtaacgctggcgtgataattttggtcgcc	CRISPR spacer
aagaagccgccggcgtgataattctggtcgat	Protospacer
  .. . ***.************.****** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1011974 : 1124608 114 Salmonella_phage(62.07%) tail,tRNA,integrase,lysis,capsid,transposase,portal,terminase,plate,head attL 1093751:1093795|attR 1120823:1120867
DBSCAN-SWA_2 1413093 : 1454913 63 Salmonella_phage(66.07%) coat,integrase,portal attL 1432357:1432373|attR 1455195:1455211
DBSCAN-SWA_3 1697429 : 1706600 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1879383 : 1886615 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_5 4315134 : 4362781 50 Burkholderia_phage(36.36%) tail,tRNA,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage