Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044189 Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-1, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP044190 Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP044188 Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome 4 crisprs DEDDh,RT,cas3,PD-DExK,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DinG 0 29 347 0

Results visualization

1. NZ_CP044189
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34339 : 70846 57 Escherichia_phage(27.27%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP044188
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044188_1 1860609-1860709 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044188_2 2287511-2289492 TypeI-E I-E
32 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044188_3 2305622-2305957 TypeI-E I-E
5 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044188_4 2306031-2306425 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044188_2 2.28|2289191|32|NZ_CP044188|PILER-CR 2289191-2289222 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
NZ_CP044188_2 2.28|2289191|32|NZ_CP044188|PILER-CR 2289191-2289222 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
NZ_CP044188_2 2.38|2289188|32|NZ_CP044188|CRISPRCasFinder,CRT 2289188-2289219 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
NZ_CP044188_2 2.38|2289188|32|NZ_CP044188|CRISPRCasFinder,CRT 2289188-2289219 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
NZ_CP044188_3 3.4|2305834|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2305834-2305865 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
NZ_CP044188_3 3.4|2305834|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2305834-2305865 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
NZ_CP044188_2 2.32|2288821|32|NZ_CP044188|CRISPRCasFinder,CRT 2288821-2288852 32 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130783-130814 2 0.938
NZ_CP044188_3 3.4|2305834|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2305834-2305865 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
NZ_CP044188_2 2.22|2288821|35|NZ_CP044188|PILER-CR 2288821-2288855 35 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130780-130814 4 0.886
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1387347-1387378 5 0.844
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1461559-1461590 5 0.844
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 599340-599371 5 0.844
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 121315-121346 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 850282-850313 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 887728-887759 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 856045-856076 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 835457-835488 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 953948-953979 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 431895-431926 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 843687-843718 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 833486-833517 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 457962-457993 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1502459-1502490 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1188725-1188756 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1094940-1094971 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 574071-574102 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 758103-758134 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 92938-92969 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1622461-1622492 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 174090-174121 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 996227-996258 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 856529-856560 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1026857-1026888 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 801217-801248 6 0.812
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 887731-887762 6 0.812
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 135155-135186 7 0.781
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 195902-195933 7 0.781
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 581076-581107 7 0.781
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 122557-122588 7 0.781
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 529537-529568 7 0.781
NZ_CP044188_2 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288089-2288120 32 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 327444-327475 7 0.781
NZ_CP044188_2 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288394-2288425 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
NZ_CP044188_2 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288394-2288425 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
NZ_CP044188_2 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288394-2288425 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 360377-360408 7 0.781
NZ_CP044188_4 4.7|2306060|32|NZ_CP044188|CRISPRCasFinder,CRT 2306060-2306091 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
NZ_CP044188_4 4.7|2306060|32|NZ_CP044188|CRISPRCasFinder,CRT 2306060-2306091 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
NZ_CP044188_4 4.7|2306060|32|NZ_CP044188|CRISPRCasFinder,CRT 2306060-2306091 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
NZ_CP044188_2 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287906-2287937 32 NC_028940 Pectobacterium bacteriophage PM2, complete genome 79087-79118 8 0.75
NZ_CP044188_2 2.8|2287967|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287967-2287998 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
NZ_CP044188_2 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288638-2288669 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
NZ_CP044188_2 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288638-2288669 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
NZ_CP044188_2 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288638-2288669 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
NZ_CP044188_2 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288638-2288669 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 43093-43124 8 0.75
NZ_CP044188_2 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288699-2288730 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 152052-152083 8 0.75
NZ_CP044188_2 2.25|2289008|32|NZ_CP044188|PILER-CR 2289008-2289039 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
NZ_CP044188_2 2.25|2289008|32|NZ_CP044188|PILER-CR 2289008-2289039 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
NZ_CP044188_2 2.35|2289005|32|NZ_CP044188|CRISPRCasFinder,CRT 2289005-2289036 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
NZ_CP044188_2 2.35|2289005|32|NZ_CP044188|CRISPRCasFinder,CRT 2289005-2289036 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
NZ_CP044188_4 4.8|2306121|32|NZ_CP044188|CRISPRCasFinder,CRT 2306121-2306152 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
NZ_CP044188_4 4.8|2306121|32|NZ_CP044188|CRISPRCasFinder,CRT 2306121-2306152 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
NZ_CP044188_4 4.11|2306304|32|NZ_CP044188|CRISPRCasFinder,CRT 2306304-2306335 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
NZ_CP044188_2 2.11|2288150|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288150-2288181 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
NZ_CP044188_2 2.11|2288150|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288150-2288181 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
NZ_CP044188_2 2.11|2288150|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288150-2288181 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
NZ_CP044188_2 2.14|2288333|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288333-2288364 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
NZ_CP044188_2 2.14|2288333|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288333-2288364 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
NZ_CP044188_2 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288394-2288425 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
NZ_CP044188_2 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288394-2288425 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
NZ_CP044188_2 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288394-2288425 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
NZ_CP044188_2 2.16|2288455|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288455-2288486 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
NZ_CP044188_2 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288638-2288669 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
NZ_CP044188_2 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288638-2288669 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
NZ_CP044188_2 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288638-2288669 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
NZ_CP044188_2 2.23|2288885|32|NZ_CP044188|PILER-CR 2288885-2288916 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
NZ_CP044188_2 2.33|2288882|32|NZ_CP044188|CRISPRCasFinder,CRT 2288882-2288913 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
NZ_CP044188_4 4.5|2306303|33|NZ_CP044188|PILER-CR 2306303-2306335 33 MN855803 Bacteriophage sp. isolate 108, partial genome 10056-10088 9 0.727
NZ_CP044188_2 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287906-2287937 32 NZ_CP042995 Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence 68697-68728 10 0.688
NZ_CP044188_2 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287906-2287937 32 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 43950-43981 10 0.688
NZ_CP044188_2 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287906-2287937 32 NZ_CP038501 Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence 49131-49162 10 0.688
NZ_CP044188_2 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287906-2287937 32 NZ_CP046044 Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence 66631-66662 10 0.688
NZ_CP044188_2 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287906-2287937 32 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 147167-147198 10 0.688
NZ_CP044188_2 2.12|2288211|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288211-2288242 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
NZ_CP044188_2 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288516-2288547 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
NZ_CP044188_2 2.29|2289252|32|NZ_CP044188|PILER-CR 2289252-2289283 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP044188_2 2.39|2289249|32|NZ_CP044188|CRISPRCasFinder,CRT 2289249-2289280 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP044188_2 2.42|2289432|32|NZ_CP044188|CRISPRCasFinder,CRT 2289432-2289463 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
NZ_CP044188_3 3.4|2305834|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2305834-2305865 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
NZ_CP044188_4 4.12|2306365|32|NZ_CP044188|CRISPRCasFinder,CRT 2306365-2306396 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP044188_4 4.12|2306365|32|NZ_CP044188|CRISPRCasFinder,CRT 2306365-2306396 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP044188_2 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287540-2287571 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1885546-1885577 11 0.656
NZ_CP044188_2 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287540-2287571 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 56201-56232 11 0.656
NZ_CP044188_2 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287540-2287571 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 83399-83430 11 0.656
NZ_CP044188_2 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287540-2287571 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1487158-1487189 11 0.656
NZ_CP044188_2 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2287540-2287571 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 597699-597730 11 0.656
NZ_CP044188_2 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288394-2288425 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
NZ_CP044188_2 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT 2288394-2288425 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656

1. spacer 2.28|2289191|32|NZ_CP044188|PILER-CR matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

2. spacer 2.28|2289191|32|NZ_CP044188|PILER-CR matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

3. spacer 2.38|2289188|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

4. spacer 2.38|2289188|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

5. spacer 3.4|2305834|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacgttcggcgatgttggccccatcggtccg	Protospacer
*******************************.

6. spacer 3.4|2305834|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacattcggcgatgttggccccatcggtcca	Protospacer
****.***************************

7. spacer 2.32|2288821|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 2, identity: 0.938

aaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
aaacgaaagaggccatgcgattgtttatcggt	Protospacer
*************.*****.************

8. spacer 3.4|2305834|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ctacgttcggtgatgttggccccataggtcca	Protospacer
*.********.************** ******

9. spacer 2.22|2288821|35|NZ_CP044188|PILER-CR matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 4, identity: 0.886

tcgaaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
atgaaacgaaagaggccatgcgattgtttatcggt	Protospacer
 .**************.*****.************

10. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * **** 

11. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * **** 

12. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * **** 

13. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812

gatcgggtggtgccggtgggccatgtggcgct--	CRISPR spacer
ggtcgggtggtgcgggtcggcca--tggcgttgg	Protospacer
*.*********** *** *****  *****.*  

14. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

15. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

16. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

17. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

18. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

19. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

20. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

21. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

22. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

23. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

24. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

25. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

26. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

27. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

28. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

29. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

30. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

31. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

32. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

33. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

34. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

35. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

36. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg--ggtggtgccggtgggccatgtggcgct	CRISPR spacer
--ccgacgctggtggcggtgggccatgtggcggc	Protospacer
  .**  * ***** ***************** .

37. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg--ggtggtgccggtgggccatgtggcgct	CRISPR spacer
--ccgacgctggtggcggtgggccatgtggcggc	Protospacer
  .**  * ***** ***************** .

38. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************  

39. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************  

40. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************  

41. spacer 2.10|2288089|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

gatcgggtggtgccggtgggccatgtggcgct	CRISPR spacer
gctagtgccgtgccggtgcgccatgtggggct	Protospacer
* * * *. ********* ********* ***

42. spacer 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

43. spacer 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcaccgccgatcctttcaccgccgcc	Protospacer
********* ********* ****. *.  **

44. spacer 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

45. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 7, identity: 0.781

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
tcttcggtgacgacattgccgaaggcgacgta	Protospacer
*.  ******** ** ************ .**

46. spacer 4.7|2306060|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

47. spacer 4.7|2306060|32|NZ_CP044188|CRISPRCasFinder,CRT matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

48. spacer 4.7|2306060|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

49. spacer 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_028940 (Pectobacterium bacteriophage PM2, complete genome) position: , mismatch: 8, identity: 0.75

gctcattaaataactatataacccccggactc	CRISPR spacer
tatcattaaataactatataacacacgagagc	Protospacer
  ******************** * **..  *

50. spacer 2.8|2287967|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttccagaaccgtttgacttactgtggccatta	CRISPR spacer
ctgccgaaccgtgtgccttactgtggccaccg	Protospacer
.* * ******* ** *************...

51. spacer 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac-	CRISPR spacer
atacgctggtctataccggcaa-ggatccgctg	Protospacer
  ******************** *.*. ** . 

52. spacer 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

53. spacer 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

54. spacer 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
ggacgctgttcaataccggcaacgtccggatc	Protospacer
 ******* ** ************  ** . *

55. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
tcgacggtgacgtccgtgacgaaggtgttcga	Protospacer
*.************ *** ******.*    *

56. spacer 2.20|2288699|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
ttctggtggacgtccgtgccgaaggcgcaatg	Protospacer
**   *  ****** ************ ***.

57. spacer 2.25|2289008|32|NZ_CP044188|PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

58. spacer 2.25|2289008|32|NZ_CP044188|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

59. spacer 2.35|2289005|32|NZ_CP044188|CRISPRCasFinder,CRT matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

60. spacer 2.35|2289005|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

61. spacer 4.8|2306121|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *. 

62. spacer 4.8|2306121|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *. 

63. spacer 4.11|2306304|32|NZ_CP044188|CRISPRCasFinder,CRT matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75

ggttaaccaggggtttttccccactatttcgc	CRISPR spacer
aggtaacgaggggtttttccccaatattgaaa	Protospacer
.* **** *************** ****  . 

64. spacer 2.11|2288150|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
ggtgcgggtgaggaactcctcgtccactgaac	Protospacer
*  **** **** **************   . 

65. spacer 2.11|2288150|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
aaggcggtggagtaactcctggtccagcccaa	Protospacer
. .***** *********** *****  .*.*

66. spacer 2.11|2288150|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
aaggcggtggagtaactcctggtccagcccaa	Protospacer
. .***** *********** *****  .*.*

67. spacer 2.14|2288333|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

68. spacer 2.14|2288333|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

69. spacer 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcagcgccgagcagttcagcaaactg	Protospacer
**************** * *****  . .*. 

70. spacer 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
gcggcatcagcgccgaccggttcaccgtcagg	Protospacer
 ***************.* *****. **    

71. spacer 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatgagcgccgatcagttcgacgccctg	Protospacer
******* ********** ****.  *. *. 

72. spacer 2.16|2288455|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719

aacaggaacaggaaaaaaaagatttgtccggt	CRISPR spacer
tacagtaacaggaaaaaaaggattaatgatgc	Protospacer
 **** *************.**** .*   *.

73. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaacggtcagcctgtccaggagga	Protospacer
****** *********** ****..**     

74. spacer 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

75. spacer 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

76. spacer 2.19|2288638|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattt	Protospacer
****.********.********** * .   .

77. spacer 2.23|2288885|32|NZ_CP044188|PILER-CR matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

78. spacer 2.33|2288882|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

79. spacer 4.5|2306303|33|NZ_CP044188|PILER-CR matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 9, identity: 0.727

gggttaaccaggggtttttccccactatttcgc	CRISPR spacer
caggtaacgaggggtttttccccaatattgaaa	Protospacer
 .* **** *************** ****  . 

80. spacer 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042995 (Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

81. spacer 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

82. spacer 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038501 (Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

83. spacer 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046044 (Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

84. spacer 2.7|2287906|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

85. spacer 2.12|2288211|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688

ctccagcgctcgaatttatttgaggccaccac	CRISPR spacer
gaacaccgcgcgaatttatttgaggcaagttt	Protospacer
   ** *** **************** * . .

86. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

87. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

88. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

89. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

90. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

91. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

92. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

93. spacer 2.17|2288516|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

94. spacer 2.29|2289252|32|NZ_CP044188|PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

95. spacer 2.39|2289249|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

96. spacer 2.42|2289432|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgttcatcggcagcgtcacgcaatatgaagat	CRISPR spacer
acatcatcggcatcgtcacgccatatccggca	Protospacer
   ********* ******** ****  .*  

97. spacer 3.4|2305834|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
actcgttcggcgatgtggcccccatccaggtg	Protospacer
 * ************* * ******* .  ..

98. spacer 4.12|2306365|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

99. spacer 4.12|2306365|32|NZ_CP044188|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

100. spacer 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

101. spacer 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

102. spacer 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgactcgatcgccttccagaccaaccttctgg	Protospacer
.   .***** ************ ****.  .

103. spacer 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

104. spacer 2.1|2287540|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

105. spacer 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

106. spacer 2.15|2288394|32|NZ_CP044188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 110529 128 Salmonella_phage(51.32%) protease,transposase,portal,head,coat,integrase,tail,terminase,plate,lysis attL 5635:5650|attR 113017:113032
DBSCAN-SWA_2 114578 : 115382 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_3 122398 : 123430 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_4 136503 : 142231 4 Saccharomonospora_phage(66.67%) transposase NA
DBSCAN-SWA_5 151045 : 151804 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_6 165239 : 166667 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_7 170650 : 170995 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_8 184385 : 185183 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_9 190376 : 192851 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_10 195867 : 197286 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_11 208051 : 217755 9 Anomala_cuprea_entomopoxvirus(25.0%) NA NA
DBSCAN-SWA_12 228727 : 230152 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_13 241193 : 241757 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_14 246014 : 247058 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_15 277372 : 278944 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_16 286993 : 287701 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_17 295677 : 301109 2 Lymphocystis_disease_virus(50.0%) NA NA
DBSCAN-SWA_18 308838 : 315152 5 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_19 322907 : 328547 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_20 334082 : 335231 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_21 354416 : 357251 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_22 363749 : 364916 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_23 369481 : 370975 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_24 391139 : 404779 12 Plodia_interpunctella_granulovirus(16.67%) transposase NA
DBSCAN-SWA_25 423529 : 424954 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_26 428903 : 434067 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_27 446219 : 447542 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_28 453089 : 455988 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_29 459764 : 460829 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_30 465803 : 467083 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_31 471337 : 472399 1 Acanthamoeba_polyphaga_lentillevirus(100.0%) NA NA
DBSCAN-SWA_32 478131 : 479793 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_33 485606 : 489116 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_34 507412 : 508621 1 uncultured_marine_virus(100.0%) transposase NA
DBSCAN-SWA_35 527948 : 529040 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_36 540422 : 541442 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_37 549251 : 554198 3 Mycoplasma_phage(50.0%) tRNA NA
DBSCAN-SWA_38 566305 : 572854 7 Paramecium_bursaria_Chlorella_virus(33.33%) transposase NA
DBSCAN-SWA_39 576519 : 579763 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_40 614716 : 616472 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_41 651683 : 652847 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_42 657710 : 662117 3 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_43 667662 : 670848 2 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_44 675869 : 676415 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_45 684139 : 685117 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_46 688844 : 689378 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_47 694454 : 696438 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_48 711337 : 711796 1 Saccharomonospora_phage(100.0%) transposase NA
DBSCAN-SWA_49 714827 : 719332 4 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_50 737502 : 745862 8 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_51 755539 : 757498 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_52 763716 : 765066 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_53 769951 : 772018 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_54 794394 : 797998 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_55 802093 : 849021 49 Burkholderia_phage(40.91%) tail,plate,tRNA NA
DBSCAN-SWA_56 852565 : 853294 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_57 859189 : 862873 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_58 877056 : 878646 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_59 884126 : 885889 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_60 896870 : 905199 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_61 909319 : 912413 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_62 921150 : 922995 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_63 944112 : 947287 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_64 970082 : 1035302 77 Escherichia_phage(40.0%) protease,head,portal,capsid,tail,terminase,integrase,holin,plate,lysis attL 999940:999986|attR 1030677:1030723
DBSCAN-SWA_65 1054031 : 1057082 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_66 1065281 : 1068076 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_67 1079479 : 1080688 1 uncultured_marine_virus(100.0%) transposase NA
DBSCAN-SWA_68 1087853 : 1088903 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_69 1094259 : 1097046 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_70 1109434 : 1110049 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_71 1120976 : 1124411 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_72 1138662 : 1140492 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_73 1145364 : 1149281 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 1168274 : 1173778 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_75 1177902 : 1183305 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_76 1186743 : 1187085 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_77 1192447 : 1194094 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_78 1209473 : 1213471 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_79 1216764 : 1217757 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_80 1230640 : 1234029 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_81 1238438 : 1245330 7 Cyanophage(33.33%) NA NA
DBSCAN-SWA_82 1256641 : 1266432 9 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_83 1271281 : 1285092 10 Oenococcus_phage(20.0%) NA NA
DBSCAN-SWA_84 1292735 : 1293687 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_85 1302191 : 1307148 5 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_86 1325738 : 1327121 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_87 1335484 : 1341520 3 Sodalis_phage(50.0%) transposase NA
DBSCAN-SWA_88 1345433 : 1353053 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_89 1360418 : 1361810 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_90 1366879 : 1371905 4 Bordetella_phage(33.33%) NA NA
DBSCAN-SWA_91 1377883 : 1382437 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_92 1396812 : 1406514 9 Prochlorococcus_phage(16.67%) NA NA
DBSCAN-SWA_93 1430363 : 1432214 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_94 1458697 : 1459693 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_95 1463555 : 1474078 12 Macacine_betaherpesvirus(20.0%) transposase NA
DBSCAN-SWA_96 1477151 : 1477610 1 Saccharomonospora_phage(100.0%) transposase NA
DBSCAN-SWA_97 1492785 : 1494779 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_98 1508869 : 1510078 1 uncultured_marine_virus(100.0%) transposase NA
DBSCAN-SWA_99 1524846 : 1525749 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_100 1540464 : 1542507 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_101 1550750 : 1553492 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_102 1558860 : 1570523 12 Dickeya_phage(28.57%) NA NA
DBSCAN-SWA_103 1576313 : 1578514 4 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_104 1581883 : 1583691 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_105 1605090 : 1607538 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_106 1621772 : 1624888 2 Halovirus(50.0%) NA NA
DBSCAN-SWA_107 1629944 : 1632338 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_108 1638397 : 1639312 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_109 1645923 : 1649686 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_110 1666725 : 1667562 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_111 1670633 : 1671092 1 Saccharomonospora_phage(100.0%) transposase NA
DBSCAN-SWA_112 1685959 : 1689956 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_113 1694542 : 1696450 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_114 1702410 : 1707981 7 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_115 1727874 : 1732194 6 Prochlorococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_116 1746218 : 1749600 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_117 1761684 : 1762728 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_118 1781178 : 1782447 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_119 1789457 : 1790825 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_120 1795694 : 1799729 4 Pseudomonas_phage(50.0%) protease NA
DBSCAN-SWA_121 1804520 : 1805624 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_122 1812390 : 1827296 17 Staphylococcus_phage(28.57%) NA NA
DBSCAN-SWA_123 1831404 : 1832895 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_124 1836241 : 1836700 1 Saccharomonospora_phage(100.0%) transposase NA
DBSCAN-SWA_125 1840329 : 1843217 2 Micromonas_pusilla_virus(50.0%) protease NA
DBSCAN-SWA_126 1846687 : 1853344 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_127 1858879 : 1860769 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_128 1867905 : 1874554 9 Invertebrate_iridovirus(25.0%) NA NA
DBSCAN-SWA_129 1890598 : 1891744 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_130 1898227 : 1900522 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_131 1913707 : 1914676 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_132 1920868 : 1937732 14 Klosneuvirus(14.29%) tRNA NA
DBSCAN-SWA_133 1942960 : 1944394 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_134 1948448 : 1949102 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_135 1954858 : 1956699 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_136 1961099 : 1962992 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_137 1966307 : 1970007 3 Stx_converting_phage(50.0%) NA NA
DBSCAN-SWA_138 1975844 : 1981548 5 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_139 1987488 : 1992629 6 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_140 2008057 : 2009530 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_141 2012929 : 2013808 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_142 2032827 : 2048844 24 Escherichia_phage(38.46%) transposase NA
DBSCAN-SWA_143 2076557 : 2077298 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_144 2080341 : 2090424 12 Staphylococcus_phage(20.0%) integrase,transposase attL 2083804:2083818|attR 2096070:2096084
DBSCAN-SWA_145 2093847 : 2094324 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_146 2112494 : 2113580 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_147 2130886 : 2132041 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_148 2137886 : 2139359 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_149 2147375 : 2148032 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_150 2159213 : 2160446 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_151 2168714 : 2174418 4 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_152 2178403 : 2190623 14 Brevibacillus_phage(14.29%) transposase,tRNA NA
DBSCAN-SWA_153 2205437 : 2207971 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_154 2218801 : 2225756 6 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_155 2231238 : 2247817 10 Klosneuvirus(16.67%) tRNA NA
DBSCAN-SWA_156 2259359 : 2260175 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_157 2265042 : 2265891 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_158 2273309 : 2278605 3 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_159 2283388 : 2287214 3 Only_Syngen_Nebraska_virus(33.33%) NA NA
DBSCAN-SWA_160 2308654 : 2310686 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_161 2313796 : 2324223 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_162 2330189 : 2334265 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_163 2339750 : 2341439 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_164 2370389 : 2371598 1 uncultured_marine_virus(100.0%) transposase NA
DBSCAN-SWA_165 2376269 : 2377091 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_166 2401007 : 2401973 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_167 2407879 : 2413426 6 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_168 2427084 : 2432139 4 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_169 2438636 : 2442640 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_170 2463011 : 2469398 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_171 2473730 : 2475911 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_172 2489475 : 2489958 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_173 2501664 : 2504907 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_174 2511692 : 2514266 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_175 2521470 : 2523331 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_176 2528632 : 2534803 7 Achromobacter_phage(25.0%) tRNA NA
DBSCAN-SWA_177 2540642 : 2548488 9 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_178 2557071 : 2568385 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_179 2575599 : 2576853 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_180 2584272 : 2594417 12 Heterosigma_akashiwo_virus(16.67%) tRNA NA
DBSCAN-SWA_181 2605216 : 2610465 5 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_182 2636763 : 2646054 3 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_183 2649103 : 2649295 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_184 2655756 : 2664349 10 Prochlorococcus_phage(20.0%) protease NA
DBSCAN-SWA_185 2667687 : 2668401 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_186 2687024 : 2691174 3 Cyanophage(50.0%) transposase NA
DBSCAN-SWA_187 2709301 : 2718853 11 Paenibacillus_phage(20.0%) NA NA
DBSCAN-SWA_188 2723884 : 2733734 9 Hokovirus(25.0%) NA NA
DBSCAN-SWA_189 2754679 : 2756655 3 Saccharomonospora_phage(50.0%) transposase NA
DBSCAN-SWA_190 2765467 : 2766409 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_191 2775589 : 2776675 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_192 2783931 : 2784717 2 Campylobacter_virus(50.0%) NA NA
DBSCAN-SWA_193 2787723 : 2788860 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_194 2795361 : 2796879 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_195 2808310 : 2809084 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_196 2812812 : 2813832 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_197 2824639 : 2827911 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_198 2849569 : 2850571 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_199 2863138 : 2868147 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_200 2871794 : 2873000 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_201 2882613 : 2940421 49 Salmonella_phage(19.05%) holin,protease,tail,transposase NA
DBSCAN-SWA_202 2950453 : 2962081 12 Salmonella_phage(33.33%) NA NA
DBSCAN-SWA_203 2965586 : 2969916 3 uncultured_marine_virus(50.0%) transposase NA
DBSCAN-SWA_204 2980056 : 2980914 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_205 2985030 : 2986953 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_206 2992392 : 2993061 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_207 2997020 : 2998541 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_208 3024595 : 3033766 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_209 3050962 : 3053821 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_210 3058245 : 3064856 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_211 3075304 : 3084604 7 Catovirus(25.0%) NA NA
DBSCAN-SWA_212 3089779 : 3096485 6 Acanthocystis_turfacea_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_213 3102073 : 3113506 11 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_214 3118212 : 3119652 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_215 3122737 : 3125547 2 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_216 3132990 : 3133890 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_217 3142553 : 3147480 4 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_218 3167183 : 3167978 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_219 3181490 : 3182306 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_220 3197826 : 3213066 17 Morganella_phage(20.0%) NA NA
DBSCAN-SWA_221 3240739 : 3241492 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_222 3249753 : 3250419 1 Sphingomonas_phage(100.0%) NA NA
DBSCAN-SWA_223 3265570 : 3269705 4 Bacillus_thuringiensis_phage(66.67%) NA NA
DBSCAN-SWA_224 3277656 : 3284216 7 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_225 3288237 : 3288759 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_226 3292861 : 3295488 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_227 3301782 : 3303258 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_228 3311157 : 3312874 3 Klebsiella_phage(50.0%) NA NA
DBSCAN-SWA_229 3315918 : 3318647 6 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_230 3326595 : 3328920 4 Salmonella_phage(33.33%) integrase attL 3323639:3323652|attR 3338049:3338062
DBSCAN-SWA_231 3337567 : 3340691 5 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_232 3348197 : 3350246 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_233 3355623 : 3355833 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_234 3363319 : 3364879 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_235 3368849 : 3376161 7 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_236 3410862 : 3413620 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_237 3416967 : 3422625 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_238 3432964 : 3434500 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_239 3439348 : 3445756 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_240 3454127 : 3457020 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_241 3468682 : 3471640 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_242 3476621 : 3481960 4 Chrysochromulina_ericina_virus(33.33%) protease NA
DBSCAN-SWA_243 3487052 : 3487643 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_244 3495468 : 3497403 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_245 3502780 : 3503587 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_246 3522072 : 3522942 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_247 3526491 : 3527349 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_248 3537566 : 3545614 10 Streptococcus_phage(20.0%) tRNA NA
DBSCAN-SWA_249 3550726 : 3551716 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_250 3556508 : 3561922 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_251 3565683 : 3566415 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_252 3572953 : 3584103 8 Synechococcus_phage(25.0%) transposase NA
DBSCAN-SWA_253 3597482 : 3599447 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_254 3617052 : 3619173 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_255 3627114 : 3628659 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_256 3636822 : 3637911 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_257 3644279 : 3645290 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_258 3666234 : 3666519 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_259 3685550 : 3686669 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_260 3695606 : 3695990 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_261 3705275 : 3724557 19 Escherichia_phage(44.44%) NA NA
DBSCAN-SWA_262 3742271 : 3746676 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_263 3768320 : 3769595 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_264 3776510 : 3777032 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_265 3782106 : 3789529 8 Streptococcus_phage(20.0%) NA NA
DBSCAN-SWA_266 3813481 : 3817820 3 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_267 3835674 : 3838884 3 environmental_halophage(50.0%) NA NA
DBSCAN-SWA_268 3861249 : 3880878 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_269 3902132 : 3902960 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_270 3909658 : 3910885 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_271 3914472 : 3916422 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_272 3921307 : 3921964 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_273 3931373 : 3934794 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_274 3949755 : 3950553 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_275 3955101 : 3955632 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_276 3960271 : 3963614 5 Enterobacterial_phage(50.0%) NA NA
DBSCAN-SWA_277 3967501 : 4017006 65 Salmonella_phage(57.89%) protease,transposase,head,tRNA,capsid,tail,terminase,integrase,holin,plate attL 3989641:3989655|attR 4013522:4013536
DBSCAN-SWA_278 4023326 : 4025310 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_279 4028896 : 4032622 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_280 4038806 : 4039064 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_281 4052225 : 4052867 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_282 4056141 : 4057268 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_283 4071087 : 4072038 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_284 4088050 : 4088296 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_285 4092954 : 4093875 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_286 4102938 : 4103478 1 Scale_drop_disease_virus(100.0%) NA NA
DBSCAN-SWA_287 4107631 : 4108465 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_288 4118553 : 4122176 3 Aeromonas_phage(33.33%) NA NA
DBSCAN-SWA_289 4130120 : 4130288 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_290 4138450 : 4138813 1 Phage_258-320(100.0%) NA NA
DBSCAN-SWA_291 4152173 : 4152854 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_292 4158627 : 4249355 101 Salmonella_phage(44.07%) protease,portal,tRNA,integrase,tail,terminase,holin,lysis attL 4184356:4184375|attR 4256143:4256162
DBSCAN-SWA_293 4264292 : 4268856 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_294 4273912 : 4275001 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_295 4279097 : 4283788 4 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_296 4288082 : 4303128 9 Escherichia_phage(28.57%) tRNA NA
DBSCAN-SWA_297 4309132 : 4317864 8 Enterobacteria_phage(14.29%) protease,transposase NA
DBSCAN-SWA_298 4324649 : 4326368 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_299 4329957 : 4332709 4 Roseobacter_phage(50.0%) NA NA
DBSCAN-SWA_300 4339508 : 4348678 11 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_301 4356249 : 4358255 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_302 4373779 : 4375651 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_303 4379972 : 4382405 1 Citrobacter_phage(100.0%) NA NA
DBSCAN-SWA_304 4387123 : 4388716 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_305 4393702 : 4399010 6 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_306 4402478 : 4411794 8 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_307 4423510 : 4424419 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_308 4433667 : 4437096 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_309 4445553 : 4453171 8 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_310 4457479 : 4458256 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_311 4463934 : 4465203 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_312 4468928 : 4472452 4 Edwardsiella_phage(33.33%) NA NA
DBSCAN-SWA_313 4498881 : 4499673 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_314 4504777 : 4511970 8 Staphylococcus_phage(33.33%) integrase attL 4501260:4501274|attR 4513210:4513224
DBSCAN-SWA_315 4515878 : 4523311 6 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_316 4526581 : 4527259 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_317 4538342 : 4548340 7 Lactobacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_318 4552993 : 4554658 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_319 4559275 : 4560361 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_320 4566261 : 4571064 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_321 4581889 : 4584472 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_322 4592699 : 4595196 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_323 4599152 : 4600682 3 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_324 4615795 : 4622342 6 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_325 4625718 : 4627544 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_326 4642016 : 4648134 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_327 4671942 : 4678792 6 Salmonella_phage(75.0%) NA NA
DBSCAN-SWA_328 4690027 : 4694461 6 Enterococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_329 4705746 : 4706895 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_330 4714345 : 4716127 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_331 4720598 : 4721615 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_332 4726468 : 4727155 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_333 4730430 : 4735648 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_334 4744748 : 4753351 8 Acanthamoeba_polyphaga_moumouvirus(25.0%) NA NA
DBSCAN-SWA_335 4773280 : 4776827 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_336 4781227 : 4781923 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_337 4785216 : 4790384 4 Bacillus_phage(25.0%) protease NA
DBSCAN-SWA_338 4811458 : 4812568 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_339 4822084 : 4823747 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_340 4828430 : 4832770 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_341 4840741 : 4850661 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_342 4854348 : 4855461 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_343 4870016 : 4871903 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_344 4885319 : 4895031 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_345 4902678 : 4903203 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_346 4915747 : 4916020 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_347 4925055 : 4925418 1 Salmonella_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage