Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 0 crisprs NA 0 0 1 0
NZ_CP044177 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome 3 crisprs DinG,cas3,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,WYL,PD-DExK 0 33 11 0
NZ_CP044180 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-3, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP044179 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-2 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP044178
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 537 : 44230 60 Vibrio_phage(36.67%) portal,plate,terminase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP044177
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044177_1 994030-994119 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044177_2 2998252-3000173 TypeI-E I-E
31 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044177_3 3016443-3017874 TypeI-E I-E
23 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 MW013502 Salmonella virus L cI-40 13-am43, complete genome 31672-31713 0 1.0
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 NC_004348 Enterobacteria phage ST64T, complete genome 14874-14915 0 1.0
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 MW013503 Salmonella virus L cII-101, complete genome 31673-31714 0 1.0
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 AY052766 Salmonella typhimurium bacteriophage ST64T, complete genome 14874-14915 0 1.0
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 MF188997 Salmonella phage vB_SalP_PM43, complete genome 14769-14810 0 1.0
NZ_CP044177_2 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT 2998281-2998312 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 35345-35376 0 1.0
NZ_CP044177_2 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT 2998281-2998312 32 NZ_CP029990 Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence 95164-95195 1 0.969
NZ_CP044177_2 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT 2998281-2998312 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 9403-9434 1 0.969
NZ_CP044177_2 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT 2998281-2998312 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 39737-39768 1 0.969
NZ_CP044177_2 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT 2998281-2998312 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 113376-113407 1 0.969
NZ_CP044177_2 2.32|2998281|34|NZ_CP044177|PILER-CR 2998281-2998314 34 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 35343-35376 1 0.971
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 CP034724 Salmonella enterica subsp. enterica serovar Stanleyville strain RSE01 plasmid pRSE01, complete sequence 17842-17873 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_LN890519 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5462388 plasmid 2, complete sequence 24214-24245 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_LN890519 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5462388 plasmid 2, complete sequence 68050-68081 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 CP034704 Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 plasmid pRSE30, complete sequence 17843-17874 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_LN890521 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5462413 plasmid 2, complete sequence 22911-22942 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_LN890521 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5462413 plasmid 2, complete sequence 68060-68091 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP040702 Salmonella enterica strain 3 isolate CFSAN047349 plasmid unnamed, complete sequence 4569-4600 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP040702 Salmonella enterica strain 3 isolate CFSAN047349 plasmid unnamed, complete sequence 54418-54449 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP034701 Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 plasmid pRSE39, complete sequence 17843-17874 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_LN890523 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 plasmid 2, complete sequence 15738-15769 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 CP042439 Salmonella enterica strain CFSAN079094 plasmid pCFSAN079094, complete sequence 14845-14876 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP014997 Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 plasmid, complete sequence 122-153 1 0.969
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP024166 Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_01, complete sequence 135422-135453 1 0.969
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 NC_011802 Salmonella enterica bacteriophage SE1, complete genome 15034-15075 2 0.952
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 CP051278 Salmonella phage ST-87, complete genome 25843-25884 2 0.952
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 CP051288 Salmonella phage ST-29, complete genome 38685-38726 2 0.952
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 CP051285 Salmonella phage ST-32, complete genome 31779-31820 2 0.952
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 NC_014900 Salmonella phage ST160, complete genome 15102-15143 2 0.952
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 CP051272 Salmonella phage SW-70, complete genome 35832-35873 2 0.952
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 CP051275 Salmonella phage SW-37, complete genome 22871-22902 2 0.938
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 JQ182733 Enterobacterial phage mEp213, complete genome 26417-26448 2 0.938
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_019706 Enterobacteria phage mEp043 c-1, complete genome 26417-26448 2 0.938
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MN856003 Bacteriophage sp. isolate 1, complete genome 31816-31847 2 0.938
NZ_CP044177_2 2.32|2998281|34|NZ_CP044177|PILER-CR 2998281-2998314 34 NZ_CP029990 Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence 95162-95195 2 0.941
NZ_CP044177_2 2.32|2998281|34|NZ_CP044177|PILER-CR 2998281-2998314 34 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 9401-9434 2 0.941
NZ_CP044177_2 2.32|2998281|34|NZ_CP044177|PILER-CR 2998281-2998314 34 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 39737-39770 2 0.941
NZ_CP044177_2 2.32|2998281|34|NZ_CP044177|PILER-CR 2998281-2998314 34 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 113374-113407 2 0.941
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP024166 Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_01, complete sequence 130852-130883 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP042629 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence 75207-75238 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 10248-10279 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NC_018998 Escherichia coli F18+ plasmid pTC1, complete sequence 4086-4117 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP042619 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence 31986-32017 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP012498 Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence 176397-176428 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP028195 Escherichia coli strain CFSAN018748 plasmid pGMI14-004_1, complete sequence 37154-37185 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP012500 Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence 4995-5026 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP012501 Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence 36496-36527 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP024975 Escherichia coli strain CV839-15 plasmid pCV839-15-p1, complete sequence 80206-80237 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP042296 Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence 114906-114937 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP024145 Escherichia coli strain 14EC029 plasmid p14EC029d, complete sequence 81191-81222 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NC_017640 Escherichia coli UMNK88 plasmid pUMNK88_Ent, complete sequence 13720-13751 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP012499 Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence 104718-104749 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP045959 Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence 1856-1887 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP045959 Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence 275069-275100 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 76719-76750 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 44203-44234 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_MG904993 Escherichia coli strain 14OD0056 plasmid p14ODTX, complete sequence 16593-16624 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NC_021871 Salmonella bongori N268-08 plasmid RM1, complete sequence 501-532 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP028170 Salmonella enterica strain CFSAN064034 plasmid pGMI17-002_1, complete sequence 42852-42883 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP022118 Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence 86641-86672 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP030224 Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence 116239-116270 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP030224 Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence 161328-161359 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP019190 Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 plasmid pATCCBAA1673_01, complete sequence 119932-119963 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 130371-130402 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP023469 Salmonella enterica subsp. enterica strain BAA-1586 plasmid pSalMiami, complete sequence 35381-35412 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_MF344572 Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence 99617-99648 2 0.938
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP019707 Pantoea alhagi strain LTYR-11Z plasmid pPALTYR11Z, complete sequence 21180-21211 2 0.938
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 35886-35917 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_006949 Enterobacteria phage ES18, complete genome 30380-30411 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 AY736146 Salmonella typhimurium bacteriophage ES18, complete sequence 30380-30411 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 45650-45681 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 BK000583 TPA_inf: Enterobacteria phage P22 wild type, complete genome 25465-25496 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MN161573 UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome 25465-25496 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 AB426868 Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1 25402-25433 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 KR296686 Salmonella phage 22, complete genome 22184-22215 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 L06296 Bacteriophage P22 eaA - eaI genes, complete cds 4154-4185 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_002371 Enterobacteria phage P22 virus, complete genome 25465-25496 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 KR296688 Salmonella phage 34, complete genome 32373-32404 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 AF217253 Bacteriophage P22 complete genome 7216-7247 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 KR296687 Salmonella phage 25, complete genome 32380-32411 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 AB362338 Enterobacteria phage P22 DNA, complete sequence, strain: MSU 25402-25433 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 AF527608 Bacteriophage P22-pbi, complete sequence 25465-25496 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 EU570103 Salmonella phage epsilon34, complete genome 25164-25195 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_047875 Salmonella phage UPF_BP1, complete genome 36125-36156 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP039495 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence 16643-16674 3 0.906
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 KJ832078 Enterobacteria phage Sf101, complete genome 20975-21006 3 0.906
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 CP051275 Salmonella phage SW-37, complete genome 22869-22902 3 0.912
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 JQ182733 Enterobacterial phage mEp213, complete genome 26417-26450 3 0.912
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_019706 Enterobacteria phage mEp043 c-1, complete genome 26417-26450 3 0.912
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MN856003 Bacteriophage sp. isolate 1, complete genome 31816-31849 3 0.912
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP026494 Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence 13741-13772 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP043952 Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence 51658-51689 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP049349 Escherichia coli strain 3R plasmid p3R-1, complete sequence 68901-68932 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 CM019851 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence 52068-52099 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP022731 Escherichia coli strain SA186 plasmid pSA186_2, complete sequence 111340-111371 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP023367 Escherichia coli strain 1428 plasmid p111, complete sequence 46712-46743 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP030791 Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence 7889-7920 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP041299 Escherichia coli O1:H42 strain CLSC36 plasmid pCys-1, complete sequence 136136-136167 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_LR740759 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202 103744-103775 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 LC484363 Escherichia coli C1 plasmid pColV-C1 DNA, complete sequence 99038-99069 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NC_007675 Escherichia coli A2363 plasmid pAPEC-O2-ColV, complete sequence 117013-117044 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP042245 Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence 157023-157054 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_MG825372 Escherichia coli strain 1106 plasmid p1106-IncFIB, complete sequence 7908-7939 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP025329 Escherichia coli strain ExPEC XM plasmid unnamed 51659-51690 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NC_023327 Escherichia coli ACN001 plasmid pACN001-B, complete sequence 51661-51692 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 15326-15357 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP030197 Salmonella enterica strain SA20051401 plasmid pSA20051401.1, complete sequence 8033-8064 3 0.906
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP030177 Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.2, complete sequence 9642-9673 3 0.906
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 MH616974 Microviridae sp. isolate ctij121, complete genome 2237-2268 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_004313 Salmonella phage ST64B, complete genome 24461-24492 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 AY055382 Salmonella typhimurium phage ST64B complete sequence 24461-24492 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MW013502 Salmonella virus L cI-40 13-am43, complete genome 24965-24996 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_004348 Enterobacteria phage ST64T, complete genome 8152-8183 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MW013503 Salmonella virus L cII-101, complete genome 24965-24996 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_010393 Phage Gifsy-2, complete genome 10151-10182 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_010392 Phage Gifsy-1, complete genome 38168-38199 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_018275 Salmonella phage vB_SemP_Emek, complete genome 25131-25162 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 AY052766 Salmonella typhimurium bacteriophage ST64T, complete genome 8152-8183 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MF188997 Salmonella phage vB_SalP_PM43, complete genome 8151-8182 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_004775 Enterobacteria phage epsilon15, complete genome 37202-37233 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP024865 Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence 11752-11783 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 12191-12222 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 36933-36964 4 0.875
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 116164-116195 4 0.875
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 35884-35917 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_006949 Enterobacteria phage ES18, complete genome 30380-30413 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 AY736146 Salmonella typhimurium bacteriophage ES18, complete sequence 30380-30413 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 KR296686 Salmonella phage 22, complete genome 22182-22215 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 KR296688 Salmonella phage 34, complete genome 32371-32404 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 KR296687 Salmonella phage 25, complete genome 32378-32411 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 45650-45683 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 BK000583 TPA_inf: Enterobacteria phage P22 wild type, complete genome 25465-25498 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MN161573 UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome 25465-25498 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 AB426868 Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1 25402-25435 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 L06296 Bacteriophage P22 eaA - eaI genes, complete cds 4154-4187 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_002371 Enterobacteria phage P22 virus, complete genome 25465-25498 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 AF217253 Bacteriophage P22 complete genome 7216-7249 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 AB362338 Enterobacteria phage P22 DNA, complete sequence, strain: MSU 25402-25435 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 AF527608 Bacteriophage P22-pbi, complete sequence 25465-25498 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 EU570103 Salmonella phage epsilon34, complete genome 25164-25197 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_047875 Salmonella phage UPF_BP1, complete genome 36125-36158 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP039495 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence 16643-16676 4 0.882
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 KJ832078 Enterobacteria phage Sf101, complete genome 20975-21008 4 0.882
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 JQ288021 Salmonella phage SPN3UB, complete genome 37698-37729 5 0.844
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 45491-45522 5 0.844
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_004313 Salmonella phage ST64B, complete genome 24461-24494 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 AY055382 Salmonella typhimurium phage ST64B complete sequence 24461-24494 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_010393 Phage Gifsy-2, complete genome 10149-10182 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_004775 Enterobacteria phage epsilon15, complete genome 37200-37233 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MW013502 Salmonella virus L cI-40 13-am43, complete genome 24965-24998 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_004348 Enterobacteria phage ST64T, complete genome 8152-8185 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MW013503 Salmonella virus L cII-101, complete genome 24965-24998 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_010392 Phage Gifsy-1, complete genome 38168-38201 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_018275 Salmonella phage vB_SemP_Emek, complete genome 25131-25164 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 AY052766 Salmonella typhimurium bacteriophage ST64T, complete genome 8152-8185 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MF188997 Salmonella phage vB_SalP_PM43, complete genome 8151-8184 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 36931-36964 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 12191-12224 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 116164-116197 5 0.853
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP024865 Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence 11752-11785 5 0.853
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 NC_016160 Escherichia phage HK75, complete genome 28592-28633 6 0.857
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 NC_019705 Enterobacteria phage mEpX2, complete genome 29046-29087 6 0.857
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 KY979108 Escherichia phage ECP1, complete genome 427-468 6 0.857
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 NC_019719 Enterobacteria phage HK633, complete genome 31740-31781 6 0.857
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 JF974339 Enterobacteria phage IME10, complete genome 9723-9764 6 0.857
NZ_CP044177_1 1.1|994054|42|NZ_CP044177|CRISPRCasFinder 994054-994095 42 NC_005344 Enterobacteria phage Sf6, complete genome 28410-28451 6 0.857
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 FN667788 Campylobacter phage CP220, complete genome 66926-66957 6 0.812
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_031077 Enterobacter phage Tyrion, complete genome 39921-39952 6 0.812
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_042346 Salmonella virus BTP1 genome assembly, chromosome: BTP1 23831-23862 6 0.812
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 MH616974 Microviridae sp. isolate ctij121, complete genome 2237-2270 6 0.824
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 JQ288021 Salmonella phage SPN3UB, complete genome 37696-37729 6 0.824
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 45489-45522 6 0.824
NZ_CP044177_2 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT 2998281-2998312 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 270963-270994 7 0.781
NZ_CP044177_2 2.9|2998769|32|NZ_CP044177|CRISPRCasFinder,CRT 2998769-2998800 32 NZ_LR699117 Aquicella lusitana strain SGT-39 plasmid 4 76569-76600 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 MT786458 Staphylococcus phage vB_SauH_SAP1, complete genome 58417-58448 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 MG557618 Staphylococcus phage HSA30, complete genome 85984-86015 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 KY779849 Staphylococcus phage qdsa002, complete genome 131154-131185 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 MF001365 Staphylococcus phage SA3, partial genome 102925-102956 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 MH159197 Staphylococcus phage VB_SavM_JYL01, complete genome 101150-101181 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 MN304941 Staphylococcus phage vB_SauH_IME522, complete genome 51528-51559 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 MK250904 Staphylococcus phage VB-SavM-JYL02, complete genome 99722-99753 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 KM216423 Staphylococcus phage P108, complete genome 66257-66288 7 0.781
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 NC_019448 Staphylococcus phage GH15, complete genome 127802-127833 7 0.781
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_031077 Enterobacter phage Tyrion, complete genome 39919-39952 7 0.794
NZ_CP044177_3 3.4|3016656|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016656-3016687 32 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 220604-220635 7 0.781
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 218580-218611 7 0.781
NZ_CP044177_3 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017265-3017296 32 JX094431 Bacillus cereus bacteriophage vB_BceM_Bc431v3, complete genome 133133-133164 7 0.781
NZ_CP044177_2 2.4|2998464|32|NZ_CP044177|CRISPRCasFinder,CRT 2998464-2998495 32 NZ_CP050100 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence 272426-272457 8 0.75
NZ_CP044177_2 2.6|2998586|32|NZ_CP044177|CRISPRCasFinder,CRT 2998586-2998617 32 NZ_CP042964 Bartonella kosoyi strain Tel Aviv plasmid pTLV-1, complete sequence 19042-19073 8 0.75
NZ_CP044177_2 2.10|2998830|33|NZ_CP044177|CRISPRCasFinder,CRT 2998830-2998862 33 CP035919 Vibrio cidicii strain 2423-01 plasmid unnamed2, complete sequence 35382-35414 8 0.758
NZ_CP044177_2 2.12|2998953|32|NZ_CP044177|CRISPRCasFinder,CRT 2998953-2998984 32 MK327941 Escherichia phage vB_EcoM_G37-3, complete genome 70559-70590 8 0.75
NZ_CP044177_2 2.12|2998953|32|NZ_CP044177|CRISPRCasFinder,CRT 2998953-2998984 32 MK327947 Escherichia phage vB_EcoM_G5211, complete genome 70151-70182 8 0.75
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 NZ_CP004877 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence 197223-197254 8 0.75
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 275300-275331 8 0.75
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 NZ_CP007616 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence 161403-161434 8 0.75
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 NZ_CP004860 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence 217020-217051 8 0.75
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 494782-494813 8 0.75
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 NZ_CP010326 Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence 137733-137764 8 0.75
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MK972697 Salmonella phage SF10, complete genome 8357-8388 8 0.75
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MK972696 Salmonella phage Si3 KFo-2019, complete genome 8222-8253 8 0.75
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MK972695 Salmonella phage SI5, complete genome 12888-12919 8 0.75
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MK972688 Salmonella phage SI8, complete genome 27221-27252 8 0.75
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 MK972689 Salmonella phage SF6, complete genome 13901-13932 8 0.75
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NC_009508 Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence 110607-110638 8 0.75
NZ_CP044177_2 2.30|3000052|32|NZ_CP044177|CRISPRCasFinder,CRT 3000052-3000083 32 AP014386 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C17, *** SEQUENCING IN PROGRESS *** 6589-6620 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN369739 Mycobacterium phage Kenuha5, complete genome 13724-13755 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KY012363 Mycobacterium phage Empress, complete genome 14952-14983 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH669010 Mycobacterium phage PHappiness, complete genome 13581-13612 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MG872841 Mycobacterium phage Priscilla, complete genome 13609-13640 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MG962361 Mycobacterium phage Alexphander, complete genome 14128-14159 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KY348865 Mycobacterium phage Bubbles123, complete genome 14317-14348 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK016496 Mycobacterium phage IrishSherpFalk, complete genome 14958-14989 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN735433 Mycobacterium phage Scottish, complete genome 14930-14961 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH669014 Mycobacterium phage Spikelee, complete genome 13425-13456 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MG770213 Mycobacterium phage OldBen, complete genome 13600-13631 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH669009 Mycobacterium phage Nimbo, complete genome 13603-13634 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH632119 Mycobacterium phage Harley, complete genome 13593-13624 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK112556 Mycobacterium phage Zerg, complete genome 13567-13598 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KX576644 Mycobacterium phage WillSterrel, complete genome 14958-14989 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KY702574 Mycobacterium phage Kingsley, complete genome 13457-13488 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN204502 Mycobacterium phage KingMidas, complete genome 14930-14961 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_022068 Mycobacteriophage Daenerys, complete genome 13603-13634 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 JF937098 Mycobacterium virus Ibhubesi, complete genome 13593-13624 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KT895281 Mycobacterium phage Cabrinians, complete genome 13600-13631 8 0.75
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KX808131 Mycobacterium phage SuperGrey, complete genome 14275-14306 8 0.75
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 FN667788 Campylobacter phage CP220, complete genome 66926-66959 8 0.765
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_042346 Salmonella virus BTP1 genome assembly, chromosome: BTP1 23831-23864 8 0.765
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NC_009508 Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence 110607-110640 8 0.765
NZ_CP044177_2 2.55|2999685|34|NZ_CP044177|PILER-CR 2999685-2999718 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 374386-374419 8 0.765
NZ_CP044177_2 2.55|2999685|34|NZ_CP044177|PILER-CR 2999685-2999718 34 MK524500 Mycobacterium phage Kevin1, complete genome 17069-17102 8 0.765
NZ_CP044177_3 3.1|3016472|32|NZ_CP044177|CRISPRCasFinder,CRT 3016472-3016503 32 JX434031 Pseudomonas phage JBD24, complete genome 2242-2273 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1360697-1360728 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1192633-1192664 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1479214-1479245 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1101414-1101445 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1254375-1254406 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1788112-1788143 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 201276-201307 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 68798-68829 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 739302-739333 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 834490-834521 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 904068-904099 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 945210-945241 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 904068-904099 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 945210-945241 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 904068-904099 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 904072-904103 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 945210-945241 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 945210-945241 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 945210-945241 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1239950-1239981 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 904068-904099 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 945212-945243 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1153739-1153770 8 0.75
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1153739-1153770 8 0.75
NZ_CP044177_3 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017265-3017296 32 NC_027352 Bacillus phage JBP901, complete genome 135769-135800 8 0.75
NZ_CP044177_3 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017265-3017296 32 MG602477 Bacillus phage BCP01, complete genome 44110-44141 8 0.75
NZ_CP044177_3 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017265-3017296 32 KX495186 Bacillus phage PK16, complete genome 134207-134238 8 0.75
NZ_CP044177_2 2.4|2998464|32|NZ_CP044177|CRISPRCasFinder,CRT 2998464-2998495 32 NZ_CP034911 Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence 88392-88423 9 0.719
NZ_CP044177_2 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT 2998892-2998923 32 NZ_CP033769 Acinetobacter baumannii strain FDAARGOS_533 plasmid unnamed1, complete sequence 43540-43571 9 0.719
NZ_CP044177_2 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT 2998892-2998923 32 CP042210 Acinetobacter baumannii strain DS002 plasmid pTS134338, complete sequence 120844-120875 9 0.719
NZ_CP044177_2 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT 2998892-2998923 32 NZ_CP038259 Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence 58875-58906 9 0.719
NZ_CP044177_2 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT 2998892-2998923 32 NZ_CP038263 Acinetobacter baumannii strain LEV1449/17Ec plasmid pEC_gr13, complete sequence 15410-15441 9 0.719
NZ_CP044177_2 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT 2999136-2999167 32 NZ_CP022726 Erwinia persicina strain B64 plasmid pEP1, complete sequence 90638-90669 9 0.719
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 72135-72166 9 0.719
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 11547-11578 9 0.719
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 MT108213 Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence 9228-9259 9 0.719
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 182643-182674 9 0.719
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 191799-191830 9 0.719
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 30766-30797 9 0.719
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 183972-184003 9 0.719
NZ_CP044177_2 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT 2999441-2999472 32 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 164926-164957 9 0.719
NZ_CP044177_2 2.21|2999502|32|NZ_CP044177|CRISPRCasFinder,CRT 2999502-2999533 32 NZ_CP022107 Halobacillus halophilus strain HL2HP6 plasmid pHL2HP62 sequence 7916-7947 9 0.719
NZ_CP044177_2 2.21|2999502|32|NZ_CP044177|CRISPRCasFinder,CRT 2999502-2999533 32 NC_017669 Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence 7085-7116 9 0.719
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 27035-27066 9 0.719
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 378555-378586 9 0.719
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 317677-317708 9 0.719
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 354955-354986 9 0.719
NZ_CP044177_2 2.25|2999746|32|NZ_CP044177|CRISPRCasFinder,CRT 2999746-2999777 32 MF140428 Mycobacterium phage Slimphazie, complete genome 51491-51522 9 0.719
NZ_CP044177_2 2.25|2999746|32|NZ_CP044177|CRISPRCasFinder,CRT 2999746-2999777 32 MN234231 Mycobacterium phage Rapunzel97, complete genome 51491-51522 9 0.719
NZ_CP044177_2 2.25|2999746|32|NZ_CP044177|CRISPRCasFinder,CRT 2999746-2999777 32 NC_023747 Mycobacterium phage BarrelRoll, complete genome 51476-51507 9 0.719
NZ_CP044177_2 2.25|2999746|32|NZ_CP044177|CRISPRCasFinder,CRT 2999746-2999777 32 MH513977 Mycobacterium phage Mynx, complete genome 51819-51850 9 0.719
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 87532-87563 9 0.719
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 76320-76351 9 0.719
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN310545 Mycobacterium phage Nitzel, complete genome 14383-14414 9 0.719
NZ_CP044177_2 2.36|2998525|34|NZ_CP044177|PILER-CR 2998525-2998558 34 NZ_CP013632 Rhizobium sp. N324 plasmid pRspN324b, complete sequence 361851-361884 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 MT786458 Staphylococcus phage vB_SauH_SAP1, complete genome 58415-58448 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 MN304941 Staphylococcus phage vB_SauH_IME522, complete genome 51526-51559 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 MG557618 Staphylococcus phage HSA30, complete genome 85984-86017 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 KY779849 Staphylococcus phage qdsa002, complete genome 131154-131187 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 MF001365 Staphylococcus phage SA3, partial genome 102925-102958 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 MH159197 Staphylococcus phage VB_SavM_JYL01, complete genome 101150-101183 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 MK250904 Staphylococcus phage VB-SavM-JYL02, complete genome 99722-99755 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 KM216423 Staphylococcus phage P108, complete genome 66257-66290 9 0.735
NZ_CP044177_2 2.46|2999136|34|NZ_CP044177|PILER-CR 2999136-2999169 34 NC_019448 Staphylococcus phage GH15, complete genome 127802-127835 9 0.735
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MK972697 Salmonella phage SF10, complete genome 8355-8388 9 0.735
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MK972696 Salmonella phage Si3 KFo-2019, complete genome 8220-8253 9 0.735
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MK972695 Salmonella phage SI5, complete genome 12886-12919 9 0.735
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MK972688 Salmonella phage SI8, complete genome 27221-27254 9 0.735
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 MK972689 Salmonella phage SF6, complete genome 13901-13934 9 0.735
NZ_CP044177_2 2.55|2999685|34|NZ_CP044177|PILER-CR 2999685-2999718 34 NZ_CP017104 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872c, complete sequence 146068-146101 9 0.735
NZ_CP044177_2 2.55|2999685|34|NZ_CP044177|PILER-CR 2999685-2999718 34 CP006879 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence 146463-146496 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MN369739 Mycobacterium phage Kenuha5, complete genome 13722-13755 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 KY012363 Mycobacterium phage Empress, complete genome 14950-14983 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MH669010 Mycobacterium phage PHappiness, complete genome 13579-13612 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MG872841 Mycobacterium phage Priscilla, complete genome 13607-13640 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MG962361 Mycobacterium phage Alexphander, complete genome 14126-14159 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 KY348865 Mycobacterium phage Bubbles123, complete genome 14315-14348 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MK016496 Mycobacterium phage IrishSherpFalk, complete genome 14956-14989 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MN735433 Mycobacterium phage Scottish, complete genome 14928-14961 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MH669014 Mycobacterium phage Spikelee, complete genome 13423-13456 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MG770213 Mycobacterium phage OldBen, complete genome 13598-13631 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MH669009 Mycobacterium phage Nimbo, complete genome 13601-13634 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MH632119 Mycobacterium phage Harley, complete genome 13591-13624 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MK112556 Mycobacterium phage Zerg, complete genome 13565-13598 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 KX576644 Mycobacterium phage WillSterrel, complete genome 14956-14989 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 KY702574 Mycobacterium phage Kingsley, complete genome 13455-13488 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 MN204502 Mycobacterium phage KingMidas, complete genome 14928-14961 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 NC_022068 Mycobacteriophage Daenerys, complete genome 13601-13634 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 JF937098 Mycobacterium virus Ibhubesi, complete genome 13591-13624 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 KT895281 Mycobacterium phage Cabrinians, complete genome 13598-13631 9 0.735
NZ_CP044177_2 2.62|3000113|34|NZ_CP044177|PILER-CR 3000113-3000146 34 KX808131 Mycobacterium phage SuperGrey, complete genome 14273-14306 9 0.735
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP022991 Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence 186517-186548 9 0.719
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 711054-711085 9 0.719
NZ_CP044177_3 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017265-3017296 32 KY271396 Klebsiella phage 2 LV-2017, complete genome 28210-28241 9 0.719
NZ_CP044177_3 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017265-3017296 32 MN364664 Xanthomonas phage Xoo-sp15, complete genome 73039-73070 9 0.719
NZ_CP044177_3 3.22|3017753|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017753-3017784 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 441156-441187 9 0.719
NZ_CP044177_3 3.22|3017753|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017753-3017784 32 NZ_CP025505 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence 109157-109188 9 0.719
NZ_CP044177_3 3.22|3017753|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017753-3017784 32 NZ_CP016290 Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence 6180-6211 9 0.719
NZ_CP044177_2 2.7|2998647|32|NZ_CP044177|CRISPRCasFinder,CRT 2998647-2998678 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 566497-566528 10 0.688
NZ_CP044177_2 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT 2998892-2998923 32 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 5490-5521 10 0.688
NZ_CP044177_2 2.22|2999563|32|NZ_CP044177|CRISPRCasFinder,CRT 2999563-2999594 32 MK672802 Vibrio phage Va_90-11-286_p16, complete genome 12262-12293 10 0.688
NZ_CP044177_2 2.22|2999563|32|NZ_CP044177|CRISPRCasFinder,CRT 2999563-2999594 32 MK672805 Vibrio phage Va_PF430-3_p42, complete genome 35024-35055 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MT889397 Mycobacterium phage OfUltron, complete genome 13837-13868 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MF668281 Mycobacterium phage RitaG, complete genome 13744-13775 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MT889396 Mycobacterium phage Seabastian, complete genome 13837-13868 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK494110 Mycobacterium phage SwagPigglett, complete genome 13609-13640 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MT553345 Mycobacterium phage LastJedi, complete genome 13599-13630 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK967397 Mycobacterium phage Mahavrat, complete genome 13594-13625 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH669003 Mycobacterium phage Girr, complete genome 13571-13602 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK016504 Mycobacterium phage Whouxphf, complete genome 13703-13734 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH155865 Mycobacterium phage BobaPhett, complete genome 13600-13631 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH590598 Mycobacterium phage Krakatau, complete genome 14298-14329 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH651169 Mycobacterium phage Burwell21, complete genome 13607-13638 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MF668271 Mycobacterium phage Geralt, complete genome 13600-13631 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK359315 Mycobacterium phage MisterCuddles, complete genome 13571-13602 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_041855 Mycobacterium phage Dorothy, complete genome 13561-13592 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK359343 Mycobacterium phage Pollywog, complete genome 14750-14781 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN586005 Mycobacterium phage Lorde, complete genome 13425-13456 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH651183 Mycobacterium phage Nivrat, complete genome 13608-13639 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MT553347 Mycobacterium phage Awesomesauce, complete genome 13468-13499 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN586012 Mycobacterium phage Blexus, complete genome 13787-13818 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK359307 Mycobacterium phage Ochi17, complete genome 13837-13868 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KT309034 Mycobacterium phage Dante, complete genome 13634-13665 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH651188 Mycobacterium phage Ruby, complete genome 13571-13602 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH590596 Mycobacterium phage Mantra, complete genome 13725-13756 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH834617 Mycobacterium phage Lizziana, complete genome 13609-13640 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_041988 Mycobacterium phage ShiLan, complete genome 13608-13639 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK524517 Mycobacterium phage James, complete genome 13600-13631 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_026585 Mycobacteriophage Estave1, complete genome 13727-13758 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KM066034 Mycobacterium phage Inventum, complete genome 13735-13766 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN586011 Mycobacterium phage LilMoolah, complete genome 13734-13765 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH399784 Mycobacterium phage NormanBulbieJr, complete genome 13594-13625 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MT310893 Mycobacterium phage DRBy19, complete genome 13632-13663 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KC736071 Mycobacterium phage WIVsmall, complete genome 39213-39244 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MG925354 Mycobacterium phage Ogopogo, complete genome 13859-13890 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH020243 Mycobacterium phage TootsiePop, complete genome 13473-13504 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN945900 Mycobacterium phage BodEinwohner17, complete genome 13771-13802 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_009820 Mycobacterium phage Tweety, complete genome 13654-13685 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MT114164 Mycobacterium phage Veteran, complete genome 13602-13633 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MF919526 Mycobacterium phage Phasih, complete genome 14139-14170 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN428051 Mycobacterium phage Modragons, complete genome 13837-13868 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_021301 Mycobacterium phage SiSi, complete genome 13592-13623 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_028923 Mycobacterium phage Llama, complete genome 13837-13868 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KY385384 Mycobacterium phage SimranZ1, complete genome 13459-13490 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_042315 Mycobacterium virus RockyHorror, complete genome 13460-13491 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MF919501 Mycobacterium phage DaWorst, complete genome 14133-14164 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN369751 Mycobacterium phage TDanisky, complete genome 13632-13663 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 JN542517 Mycobacterium phage Drago, complete genome 13425-13456 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MF668270 Mycobacterium phage Emma, complete genome 13651-13682 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH669005 Mycobacterium phage JoeyJr, complete genome 13771-13802 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH020242 Mycobacterium phage Misha28, complete genome 13473-13504 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH001448 Mycobacterium phage UncleRicky, complete genome 13425-13456 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_028654 Mycobacterium phage Sparkdehlily, complete genome 13632-13663 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN585975 Mycobacterium phage Eish, complete genome 13743-13774 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK875792 Mycobacterium phage Polka14, complete genome 14143-14174 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 KX610764 Mycobacterium phage Kersh, complete genome 13714-13745 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MN585987 Mycobacterium phage Enby, complete genome 13425-13456 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MH155871 Mycobacterium phage Mattes, complete genome 13600-13631 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 JN398368 Mycobacterium virus GUmbie, complete genome 13602-13633 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 NC_028844 Mycobacterium phage Phatniss, complete genome 14107-14138 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 MK494120 Mycobacterium phage Piper2020, complete genome 13473-13504 10 0.688
NZ_CP044177_2 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT 3000113-3000144 32 FJ174692 Mycobacterium phage Pacc40, complete genome 13771-13802 10 0.688
NZ_CP044177_2 2.43|2998953|34|NZ_CP044177|PILER-CR 2998953-2998986 34 MK327941 Escherichia phage vB_EcoM_G37-3, complete genome 70559-70592 10 0.706
NZ_CP044177_2 2.43|2998953|34|NZ_CP044177|PILER-CR 2998953-2998986 34 MK327947 Escherichia phage vB_EcoM_G5211, complete genome 70151-70184 10 0.706
NZ_CP044177_2 2.51|2999441|34|NZ_CP044177|PILER-CR 2999441-2999474 34 NZ_CP010326 Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence 137731-137764 10 0.706
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 27033-27066 10 0.706
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 317675-317708 10 0.706
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 378555-378588 10 0.706
NZ_CP044177_2 2.54|2999624|34|NZ_CP044177|PILER-CR 2999624-2999657 34 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 354955-354988 10 0.706
NZ_CP044177_2 2.55|2999685|34|NZ_CP044177|PILER-CR 2999685-2999718 34 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 202743-202776 10 0.706
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 236279-236310 10 0.688
NZ_CP044177_3 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016717-3016748 32 NZ_CP045421 Maribius sp. THAF1 plasmid pTHAF1_a, complete sequence 4186-4217 10 0.688
NZ_CP044177_3 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017265-3017296 32 MK448236 Klebsiella phage ST899-OXA48phi17.1, complete genome 796-827 10 0.688
NZ_CP044177_3 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017265-3017296 32 MK714353 Klebsiella phage ST13-OXA48phi12.5, complete genome 14408-14439 10 0.688
NZ_CP044177_3 3.22|3017753|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017753-3017784 32 MH834627 Arthrobacter phage Ryan, complete genome 8036-8067 10 0.688
NZ_CP044177_3 3.23|3017814|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3017814-3017845 32 NC_015694 Runella slithyformis DSM 19594 plasmid pRUNSL03, complete sequence 56635-56666 10 0.688
NZ_CP044177_2 2.12|2998953|32|NZ_CP044177|CRISPRCasFinder,CRT 2998953-2998984 32 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 27895-27926 11 0.656
NZ_CP044177_2 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT 2999624-2999655 32 NZ_CP010024 Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence 204911-204942 11 0.656
NZ_CP044177_2 2.35|2998464|34|NZ_CP044177|PILER-CR 2998464-2998497 34 NZ_CP034911 Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence 88390-88423 11 0.676
NZ_CP044177_2 2.51|2999441|34|NZ_CP044177|PILER-CR 2999441-2999474 34 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 72133-72166 11 0.676
NZ_CP044177_2 2.51|2999441|34|NZ_CP044177|PILER-CR 2999441-2999474 34 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 11547-11580 11 0.676
NZ_CP044177_2 2.51|2999441|34|NZ_CP044177|PILER-CR 2999441-2999474 34 MT108213 Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence 9228-9261 11 0.676
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 1010535-1010566 11 0.656
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 1193921-1193952 11 0.656
NZ_CP044177_3 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR 3016778-3016809 32 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 565982-566013 11 0.656

1. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

2. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

3. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

4. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

5. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

6. spacer 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0

ggccgatgggcggatatccaggcgttgtgcga	CRISPR spacer
ggccgatgggcggatatccaggcgttgtgcga	Protospacer
********************************

7. spacer 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 1, identity: 0.969

ggccgatgggcggatatccaggcgttgtgcga	CRISPR spacer
ggccgatgggcgaatatccaggcgttgtgcga	Protospacer
************.*******************

8. spacer 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggccgatgggcggatatccaggcgttgtgcga	CRISPR spacer
ggccgatgggcgaatatccaggcgttgtgcga	Protospacer
************.*******************

9. spacer 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggccgatgggcggatatccaggcgttgtgcga	CRISPR spacer
ggccgatgggcgaatatccaggcgttgtgcga	Protospacer
************.*******************

10. spacer 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggccgatgggcggatatccaggcgttgtgcga	CRISPR spacer
ggccgatgggcgaatatccaggcgttgtgcga	Protospacer
************.*******************

11. spacer 2.32|2998281|34|NZ_CP044177|PILER-CR matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 1, identity: 0.971

ggccgatgggcggatatccaggcgttgtgcgacg	CRISPR spacer
ggccgatgggcggatatccaggcgttgtgcgact	Protospacer
********************************* 

12. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to CP034724 (Salmonella enterica subsp. enterica serovar Stanleyville strain RSE01 plasmid pRSE01, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

13. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN890519 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5462388 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

14. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN890519 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5462388 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

15. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to CP034704 (Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 plasmid pRSE30, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

16. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN890521 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5462413 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

17. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN890521 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5462413 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

18. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040702 (Salmonella enterica strain 3 isolate CFSAN047349 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

19. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040702 (Salmonella enterica strain 3 isolate CFSAN047349 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

20. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034701 (Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 plasmid pRSE39, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

21. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN890523 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

22. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to CP042439 (Salmonella enterica strain CFSAN079094 plasmid pCFSAN079094, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

23. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014997 (Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 plasmid, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

24. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024166 (Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_01, complete sequence) position: , mismatch: 1, identity: 0.969

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggttgccggtgcgtaatccct	Protospacer
.*******************************

25. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to NC_011802 (Salmonella enterica bacteriophage SE1, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

26. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to CP051278 (Salmonella phage ST-87, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

27. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to CP051288 (Salmonella phage ST-29, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

28. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to CP051285 (Salmonella phage ST-32, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

29. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to NC_014900 (Salmonella phage ST160, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

30. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to CP051272 (Salmonella phage SW-70, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

31. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 2, identity: 0.938

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgtagcgcctgtttgtcgatgttgct	Protospacer
 .******************************

32. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to JQ182733 (Enterobacterial phage mEp213, complete genome) position: , mismatch: 2, identity: 0.938

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
atttcacgcagcgcctgtttgtcgatgttgct	Protospacer
.*******.***********************

33. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_019706 (Enterobacteria phage mEp043 c-1, complete genome) position: , mismatch: 2, identity: 0.938

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
atttcacgcagcgcctgtttgtcgatgttgct	Protospacer
.*******.***********************

34. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 2, identity: 0.938

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
gcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
*.******.***********************

35. spacer 2.32|2998281|34|NZ_CP044177|PILER-CR matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 2, identity: 0.941

ggccgatgggcggatatccaggcgttgtgcgacg	CRISPR spacer
ggccgatgggcgaatatccaggcgttgtgcgact	Protospacer
************.******************** 

36. spacer 2.32|2998281|34|NZ_CP044177|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ggccgatgggcggatatccaggcgttgtgcgacg	CRISPR spacer
ggccgatgggcgaatatccaggcgttgtgcgact	Protospacer
************.******************** 

37. spacer 2.32|2998281|34|NZ_CP044177|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ggccgatgggcggatatccaggcgttgtgcgacg	CRISPR spacer
ggccgatgggcgaatatccaggcgttgtgcgact	Protospacer
************.******************** 

38. spacer 2.32|2998281|34|NZ_CP044177|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ggccgatgggcggatatccaggcgttgtgcgacg	CRISPR spacer
ggccgatgggcgaatatccaggcgttgtgcgact	Protospacer
************.******************** 

39. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024166 (Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_01, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggctgccggtgcgtaacccct	Protospacer
*************.*************.****

40. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042629 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

41. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

42. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NC_018998 (Escherichia coli F18+ plasmid pTC1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

43. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042619 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

44. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012498 (Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

45. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028195 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

46. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012500 (Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

47. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

48. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024975 (Escherichia coli strain CV839-15 plasmid pCV839-15-p1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

49. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042296 (Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

50. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024145 (Escherichia coli strain 14EC029 plasmid p14EC029d, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

51. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NC_017640 (Escherichia coli UMNK88 plasmid pUMNK88_Ent, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

52. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012499 (Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

53. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045959 (Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacagcggttgccggtgcgtaatccct	Protospacer
.********.**********************

54. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045959 (Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacagcggttgccggtgcgtaatccct	Protospacer
.********.**********************

55. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

56. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

57. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG904993 (Escherichia coli strain 14OD0056 plasmid p14ODTX, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacaacggtttccggtgcgtaatccct	Protospacer
.************** ****************

58. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NC_021871 (Salmonella bongori N268-08 plasmid RM1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggaaaacaacggctgccggtgcgtaatccct	Protospacer
*** *********.******************

59. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028170 (Salmonella enterica strain CFSAN064034 plasmid pGMI17-002_1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggctgccggtgcgtaacccct	Protospacer
*************.*************.****

60. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022118 (Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacagttgccggtgcgtaacccct	Protospacer
***********.***************.****

61. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030224 (Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggctgccggtgcgtaacccct	Protospacer
*************.*************.****

62. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030224 (Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggctgccggtgcgtaacccct	Protospacer
*************.*************.****

63. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019190 (Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 plasmid pATCCBAA1673_01, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggctgccggtgcgtaacccct	Protospacer
*************.*************.****

64. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacagcggttgccggtgcgtaatcctt	Protospacer
*********.********************.*

65. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023469 (Salmonella enterica subsp. enterica strain BAA-1586 plasmid pSalMiami, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggtaaacaacggctgccggtgcgtaatccct	Protospacer
***.*********.******************

66. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF344572 (Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggtaaacaacggctgccggtgcgtaatccct	Protospacer
***.*********.******************

67. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019707 (Pantoea alhagi strain LTYR-11Z plasmid pPALTYR11Z, complete sequence) position: , mismatch: 2, identity: 0.938

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgccggtgcgcaacccct	Protospacer
************************.**.****

68. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
cgctcacgtagcgcctgtttgtcgatgttgct	Protospacer
  .*****************************

69. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_006949 (Enterobacteria phage ES18, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
cgctcacgtagcgcctgtttgtcgatgttgct	Protospacer
  .*****************************

70. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to AY736146 (Salmonella typhimurium bacteriophage ES18, complete sequence) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
cgctcacgtagcgcctgtttgtcgatgttgct	Protospacer
  .*****************************

71. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcctgtttgtcgatgttgct	Protospacer
..****** ***********************

72. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to BK000583 (TPA_inf: Enterobacteria phage P22 wild type, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

73. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN161573 (UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

74. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to AB426868 (Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

75. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KR296686 (Salmonella phage 22, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

76. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to L06296 (Bacteriophage P22 eaA - eaI genes, complete cds) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

77. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_002371 (Enterobacteria phage P22 virus, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

78. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KR296688 (Salmonella phage 34, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

79. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to AF217253 (Bacteriophage P22 complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

80. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KR296687 (Salmonella phage 25, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

81. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to AB362338 (Enterobacteria phage P22 DNA, complete sequence, strain: MSU) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

82. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to AF527608 (Bacteriophage P22-pbi, complete sequence) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

83. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to EU570103 (Salmonella phage epsilon34, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

84. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgct	Protospacer
 .******.***********************

85. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP039495 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
gattcccgcagcgcctgtttgtcgatgttgct	Protospacer
* *** **.***********************

86. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KJ832078 (Enterobacteria phage Sf101, complete genome) position: , mismatch: 3, identity: 0.906

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
gcttcacgcagcgcctgtttgttgatgttgct	Protospacer
*.******.*************.*********

87. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 3, identity: 0.912

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgtagcgcctgtttgtcgatgttgctca	Protospacer
 .*******************************.

88. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to JQ182733 (Enterobacterial phage mEp213, complete genome) position: , mismatch: 3, identity: 0.912

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
atttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
.*******.************************.

89. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_019706 (Enterobacteria phage mEp043 c-1, complete genome) position: , mismatch: 3, identity: 0.912

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
atttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
.*******.************************.

90. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 3, identity: 0.912

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
gcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
*.******.************************.

91. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026494 (Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

92. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043952 (Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

93. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049349 (Escherichia coli strain 3R plasmid p3R-1, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

94. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to CM019851 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

95. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022731 (Escherichia coli strain SA186 plasmid pSA186_2, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

96. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023367 (Escherichia coli strain 1428 plasmid p111, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

97. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030791 (Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

98. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041299 (Escherichia coli O1:H42 strain CLSC36 plasmid pCys-1, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

99. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

100. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to LC484363 (Escherichia coli C1 plasmid pColV-C1 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

101. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NC_007675 (Escherichia coli A2363 plasmid pAPEC-O2-ColV, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

102. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

103. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG825372 (Escherichia coli strain 1106 plasmid p1106-IncFIB, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

104. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025329 (Escherichia coli strain ExPEC XM plasmid unnamed) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

105. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NC_023327 (Escherichia coli ACN001 plasmid pACN001-B, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gggcaaacaacggttgtcggtgcgtaatcctc	Protospacer
****************.*************..

106. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
aggcaaacagaggttgccggtgcgtaatccct	Protospacer
.********. *********************

107. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030197 (Salmonella enterica strain SA20051401 plasmid pSA20051401.1, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
ggataaacaacggctgccggtgcgtaatccct	Protospacer
**..*********.******************

108. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030177 (Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.2, complete sequence) position: , mismatch: 3, identity: 0.906

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
ggataaacaacggctgccggtgcgtaatccct	Protospacer
**..*********.******************

109. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH616974 (Microviridae sp. isolate ctij121, complete genome) position: , mismatch: 4, identity: 0.875

acaaagggaattaaaatgaacaaatca-gtaat	CRISPR spacer
acaaaggaaattaaaatgaacaaattacgtga-	Protospacer
*******.*****************.* **.* 

110. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
cgctctcgtagcgcctgtttgtcgatgttgct	Protospacer
  .** **************************

111. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
cgctctcgtagcgcctgtttgtcgatgttgct	Protospacer
  .** **************************

112. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgct	Protospacer
..****** ******.****************

113. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgct	Protospacer
..****** ******.****************

114. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgct	Protospacer
..****** ******.****************

115. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_010393 (Phage Gifsy-2, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgct	Protospacer
..****** ******.****************

116. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgct	Protospacer
..****** ******.****************

117. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_018275 (Salmonella phage vB_SemP_Emek, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgct	Protospacer
..****** ******.****************

118. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgct	Protospacer
..****** ******.****************

119. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgct	Protospacer
..****** ******.****************

120. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgcagcacctgtttgtcgatgttgct	Protospacer
 .******.***.*******************

121. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP024865 (Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
gcctcacgtagcgccagtgtgtcgatgttgct	Protospacer
*..************ ** *************

122. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
ttctgacgcagcgcctgtttgtcgatgttgct	Protospacer
 *.* ***.***********************

123. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
ttctgacgcagcgcctgtttgtcgatgttgct	Protospacer
 *.* ***.***********************

124. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
ttctgacgcagcgcctgtttgtcgatgttgct	Protospacer
 *.* ***.***********************

125. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
cgctcacgtagcgcctgtttgtcgatgttgctca	Protospacer
  .******************************.

126. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_006949 (Enterobacteria phage ES18, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
cgctcacgtagcgcctgtttgtcgatgttgctca	Protospacer
  .******************************.

127. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to AY736146 (Salmonella typhimurium bacteriophage ES18, complete sequence) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
cgctcacgtagcgcctgtttgtcgatgttgctca	Protospacer
  .******************************.

128. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to KR296686 (Salmonella phage 22, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

129. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to KR296688 (Salmonella phage 34, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

130. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to KR296687 (Salmonella phage 25, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

131. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcctgtttgtcgatgttgctca	Protospacer
..****** ************************.

132. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to BK000583 (TPA_inf: Enterobacteria phage P22 wild type, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

133. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MN161573 (UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

134. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to AB426868 (Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

135. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to L06296 (Bacteriophage P22 eaA - eaI genes, complete cds) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

136. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_002371 (Enterobacteria phage P22 virus, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

137. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to AF217253 (Bacteriophage P22 complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

138. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to AB362338 (Enterobacteria phage P22 DNA, complete sequence, strain: MSU) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

139. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to AF527608 (Bacteriophage P22-pbi, complete sequence) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

140. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to EU570103 (Salmonella phage epsilon34, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

141. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcgcctgtttgtcgatgttgctca	Protospacer
 .******.************************.

142. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP039495 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
gattcccgcagcgcctgtttgtcgatgttgctca	Protospacer
* *** **.************************.

143. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to KJ832078 (Enterobacteria phage Sf101, complete genome) position: , mismatch: 4, identity: 0.882

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
gcttcacgcagcgcctgtttgttgatgttgctca	Protospacer
*.******.*************.**********.

144. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 5, identity: 0.844

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
gcacccagtagcgcctgtttgtcgatgttgct	Protospacer
*. .*  *************************

145. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gtttcacg----tagcgcctgtttgtcgatgttgct	CRISPR spacer
----cgcgaccttagcgcctgtttgtcgatgttgct	Protospacer
    *.**    ************************

146. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
cgctctcgtagcgcctgtttgtcgatgttgctca	Protospacer
  .** ***************************.

147. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
cgctctcgtagcgcctgtttgtcgatgttgctca	Protospacer
  .** ***************************.

148. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_010393 (Phage Gifsy-2, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgctca	Protospacer
..****** ******.*****************.

149. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
tcttcacgcagcacctgtttgtcgatgttgctca	Protospacer
 .******.***.********************.

150. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgctca	Protospacer
..****** ******.*****************.

151. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgctca	Protospacer
..****** ******.*****************.

152. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgctca	Protospacer
..****** ******.*****************.

153. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgctca	Protospacer
..****** ******.*****************.

154. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_018275 (Salmonella phage vB_SemP_Emek, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgctca	Protospacer
..****** ******.*****************.

155. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgctca	Protospacer
..****** ******.*****************.

156. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgaagcgcccgtttgtcgatgttgctca	Protospacer
..****** ******.*****************.

157. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
ttctgacgcagcgcctgtttgtcgatgttgctca	Protospacer
 *.* ***.************************.

158. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
ttctgacgcagcgcctgtttgtcgatgttgctca	Protospacer
 *.* ***.************************.

159. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
ttctgacgcagcgcctgtttgtcgatgttgctca	Protospacer
 *.* ***.************************.

160. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP024865 (Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 5, identity: 0.853

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
gcctcacgtagcgccagtgtgtcgatgttgctca	Protospacer
*..************ ** **************.

161. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to NC_016160 (Escherichia phage HK75, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

162. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to NC_019705 (Enterobacteria phage mEpX2, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

163. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to KY979108 (Escherichia phage ECP1, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

164. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to NC_019719 (Enterobacteria phage HK633, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

165. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to JF974339 (Enterobacteria phage IME10, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

166. spacer 1.1|994054|42|NZ_CP044177|CRISPRCasFinder matches to NC_005344 (Enterobacteria phage Sf6, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

167. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to FN667788 (Campylobacter phage CP220, complete genome) position: , mismatch: 6, identity: 0.812

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
caaaaggtaattaaaatgaataaatcagaatt	Protospacer
  ***** ************.******* * *

168. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_031077 (Enterobacter phage Tyrion, complete genome) position: , mismatch: 6, identity: 0.812

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
aaatttcgcagcgcctgtttgtcgatgttgct	Protospacer
.  *. **.***********************

169. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_042346 (Salmonella virus BTP1 genome assembly, chromosome: BTP1) position: , mismatch: 6, identity: 0.812

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acttcacgtagcgtccgtttgtcgatgttcat	Protospacer
..***********.*.*************  *

170. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to MH616974 (Microviridae sp. isolate ctij121, complete genome) position: , mismatch: 6, identity: 0.824

acaaagggaattaaaatgaacaaatca---gtaatcg	CRISPR spacer
acaaaggaaattaaaatgaacaaattacgtgaaa---	Protospacer
*******.*****************.*   * **   

171. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 6, identity: 0.824

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
gcacccagtagcgcctgtttgtcgatgttgctca	Protospacer
*. .*  **************************.

172. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

gtttcacg----tagcgcctgtttgtcgatgttgctcg	CRISPR spacer
----cgcgaccttagcgcctgtttgtcgatgttgctca	Protospacer
    *.**    *************************.

173. spacer 2.1|2998281|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggccgatgggcggatatccaggcgttgtgcga	CRISPR spacer
cggcggtgggcggagatccaggcgtttctcga	Protospacer
 * **.******** *********** . ***

174. spacer 2.9|2998769|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_LR699117 (Aquicella lusitana strain SGT-39 plasmid 4) position: , mismatch: 7, identity: 0.781

aaaagattgagtcagcacataatca---cagtttg	CRISPR spacer
aaacgattgagtcagcacaaaattattctagt---	Protospacer
*** *************** ***.*   .***   

175. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MT786458 (Staphylococcus phage vB_SauH_SAP1, complete genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

176. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MG557618 (Staphylococcus phage HSA30, complete genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

177. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KY779849 (Staphylococcus phage qdsa002, complete genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

178. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MF001365 (Staphylococcus phage SA3, partial genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

179. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH159197 (Staphylococcus phage VB_SavM_JYL01, complete genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

180. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN304941 (Staphylococcus phage vB_SauH_IME522, complete genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

181. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK250904 (Staphylococcus phage VB-SavM-JYL02, complete genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

182. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KM216423 (Staphylococcus phage P108, complete genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

183. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_019448 (Staphylococcus phage GH15, complete genome) position: , mismatch: 7, identity: 0.781

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtaga	Protospacer
* ..***.**************** *****. 

184. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_031077 (Enterobacter phage Tyrion, complete genome) position: , mismatch: 7, identity: 0.794

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
aaatttcgcagcgcctgtttgtcgatgttgctca	Protospacer
.  *. **.************************.

185. spacer 3.4|3016656|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.781

caccatgacgcatcccacggccatccccacgg	CRISPR spacer
cgacccgacgcatcccacggccaccaccaccg	Protospacer
*. * .*****************.* **** *

186. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 7, identity: 0.781

tgcgacccggccggaccgggcaccattaccac	CRISPR spacer
agcaccgaggccggaccgtgcaccatttccac	Protospacer
 **. *  ********** ******** ****

187. spacer 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to JX094431 (Bacillus cereus bacteriophage vB_BceM_Bc431v3, complete genome) position: , mismatch: 7, identity: 0.781

gatgttatcaacgtcaacgttaaacgtgtcca	CRISPR spacer
gctactatcaacgtaaacgttaaaggtgacga	Protospacer
* *..********* ********* *** * *

188. spacer 2.4|2998464|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP050100 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence) position: , mismatch: 8, identity: 0.75

accagatcgtgccccagttccagcaactgacg	CRISPR spacer
acatgtcgctgccccagctcgagcaactgacg	Protospacer
**  * .  ********.** ***********

189. spacer 2.6|2998586|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP042964 (Bartonella kosoyi strain Tel Aviv plasmid pTLV-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcattgaaaacgggccagaaaaatagataatt	CRISPR spacer
ttttagaaaactggcaagaaaaatagattttt	Protospacer
 . * ****** *** ************  **

190. spacer 2.10|2998830|33|NZ_CP044177|CRISPRCasFinder,CRT matches to CP035919 (Vibrio cidicii strain 2423-01 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

gcgcgccgagccgagctgatagagcagatacgg	CRISPR spacer
acaacccgagccgagcttatagagcagatcaag	Protospacer
.*.  ************ ***********  .*

191. spacer 2.12|2998953|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK327941 (Escherichia phage vB_EcoM_G37-3, complete genome) position: , mismatch: 8, identity: 0.75

----tgcgacggaatgcacctggcgccagaaatatt	CRISPR spacer
gtattgt----taatgcaactggcgccagtaatatt	Protospacer
    **.     ****** ********** ******

192. spacer 2.12|2998953|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK327947 (Escherichia phage vB_EcoM_G5211, complete genome) position: , mismatch: 8, identity: 0.75

----tgcgacggaatgcacctggcgccagaaatatt	CRISPR spacer
gtattgt----taatgcaactggcgccagtaatatt	Protospacer
    **.     ****** ********** ******

193. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP004877 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence) position: , mismatch: 8, identity: 0.75

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaaaagggaatgaatatgaacaaatgaaagaa	Protospacer
* ********* ** ********** *. .* 

194. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 8, identity: 0.75

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaaaagggaatgaatatgaacaaatgaaagaa	Protospacer
* ********* ** ********** *. .* 

195. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP007616 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence) position: , mismatch: 8, identity: 0.75

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaaaagggaatgaatatgaacaaatgaaagaa	Protospacer
* ********* ** ********** *. .* 

196. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP004860 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence) position: , mismatch: 8, identity: 0.75

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
aaaaagggaatgaatatgaacaaatgaaagaa	Protospacer
* ********* ** ********** *. .* 

197. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 8, identity: 0.75

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
tattccagcacgtcagcaccggtaacgatatc	Protospacer
   ********.**************. ..**

198. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 8, identity: 0.75

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
tactccagtacatcagcaccggtgacaatatc	Protospacer
   *****.**************.*** ..**

199. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK972697 (Salmonella phage SF10, complete genome) position: , mismatch: 8, identity: 0.75

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcat	Protospacer
 .*******************..***  *  *

200. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK972696 (Salmonella phage Si3 KFo-2019, complete genome) position: , mismatch: 8, identity: 0.75

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcat	Protospacer
 .*******************..***  *  *

201. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK972695 (Salmonella phage SI5, complete genome) position: , mismatch: 8, identity: 0.75

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcat	Protospacer
 .*******************..***  *  *

202. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK972688 (Salmonella phage SI8, complete genome) position: , mismatch: 8, identity: 0.75

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcat	Protospacer
 .*******************..***  *  *

203. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK972689 (Salmonella phage SF6, complete genome) position: , mismatch: 8, identity: 0.75

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcat	Protospacer
 .*******************..***  *  *

204. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_009508 (Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence) position: , mismatch: 8, identity: 0.75

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
gtgccctcgagcgcctgtttgtcgagtttgct	Protospacer
** .* .  ****************  *****

205. spacer 2.30|3000052|32|NZ_CP044177|CRISPRCasFinder,CRT matches to AP014386 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C17, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

tactgaggaaaacccaaaaacgcctgatttcg	CRISPR spacer
gactccagaaaaccccaaaatgcctgatttta	Protospacer
 ***  .******** ****.*********..

206. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

207. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KY012363 (Mycobacterium phage Empress, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

208. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH669010 (Mycobacterium phage PHappiness, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

209. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MG872841 (Mycobacterium phage Priscilla, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

210. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MG962361 (Mycobacterium phage Alexphander, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

211. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

212. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK016496 (Mycobacterium phage IrishSherpFalk, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

213. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN735433 (Mycobacterium phage Scottish, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

214. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH669014 (Mycobacterium phage Spikelee, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

215. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MG770213 (Mycobacterium phage OldBen, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

216. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH669009 (Mycobacterium phage Nimbo, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

217. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH632119 (Mycobacterium phage Harley, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

218. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK112556 (Mycobacterium phage Zerg, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

219. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KX576644 (Mycobacterium phage WillSterrel, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

220. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KY702574 (Mycobacterium phage Kingsley, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

221. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN204502 (Mycobacterium phage KingMidas, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

222. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_022068 (Mycobacteriophage Daenerys, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

223. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to JF937098 (Mycobacterium virus Ibhubesi, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

224. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KT895281 (Mycobacterium phage Cabrinians, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

225. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KX808131 (Mycobacterium phage SuperGrey, complete genome) position: , mismatch: 8, identity: 0.75

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcg	Protospacer
.*.   .********* ****** ********

226. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to FN667788 (Campylobacter phage CP220, complete genome) position: , mismatch: 8, identity: 0.765

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
caaaaggtaattaaaatgaataaatcagaattta	Protospacer
  ***** ************.******* * *..

227. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_042346 (Salmonella virus BTP1 genome assembly, chromosome: BTP1) position: , mismatch: 8, identity: 0.765

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
acttcacgtagcgtccgtttgtcgatgttcatgc	Protospacer
..***********.*.*************  *  

228. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NC_009508 (Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence) position: , mismatch: 8, identity: 0.765

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
gtgccctcgagcgcctgtttgtcgagtttgctcg	Protospacer
** .* .  ****************  *******

229. spacer 2.55|2999685|34|NZ_CP044177|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.765

gtagtcagga---ccgctgacgcgttcgaaatcgtcg	CRISPR spacer
---ggcacggcttccgccgccgcgttcgaaatcgtcg	Protospacer
   * ** *.   ****.* *****************

230. spacer 2.55|2999685|34|NZ_CP044177|PILER-CR matches to MK524500 (Mycobacterium phage Kevin1, complete genome) position: , mismatch: 8, identity: 0.765

gtagtcaggaccgctgacgcgttcgaaatcgtcg	CRISPR spacer
gtgaacaatgccgccgacgcgttcgagatcgtcg	Protospacer
**.. **. .****.***********.*******

231. spacer 3.1|3016472|32|NZ_CP044177|CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 8, identity: 0.75

taact--catcacatccgcgtcagacctcgtgac	CRISPR spacer
--actgccatcacattcgcggcagacctcgccga	Protospacer
  ***  ********.**** *********. . 

232. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

233. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

234. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

235. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

236. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

237. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

238. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

239. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcaccattaccac--	CRISPR spacer
ggcggcccggccggaccgggccccg--gccagga	Protospacer
 ***.**************** **.  .***   

240. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

241. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

242. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

243. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

244. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

245. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

246. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

247. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

248. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

249. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

250. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

251. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

252. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

253. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

254. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

255. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgacccggccggaccgggcacc-attaccac	CRISPR spacer
cgcgacccagccgaaccgggcaccggtcgaca-	Protospacer
.*******.****.********** .*.. ** 

256. spacer 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NC_027352 (Bacillus phage JBP901, complete genome) position: , mismatch: 8, identity: 0.75

gatgttatcaacgtcaacgttaaacgtgtcca	CRISPR spacer
gccactatcaacgtcaatgttaaaggtgacga	Protospacer
* ...************.****** *** * *

257. spacer 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to MG602477 (Bacillus phage BCP01, complete genome) position: , mismatch: 8, identity: 0.75

gatgttatcaacgtcaacgttaaacgtgtcca	CRISPR spacer
gccactatcaacgtcaatgttaaaggtgacga	Protospacer
* ...************.****** *** * *

258. spacer 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to KX495186 (Bacillus phage PK16, complete genome) position: , mismatch: 8, identity: 0.75

gatgttatcaacgtcaacgttaaacgtgtcca	CRISPR spacer
gccactatcaacgtcaatgttaaaggtgacga	Protospacer
* ...************.****** *** * *

259. spacer 2.4|2998464|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP034911 (Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

accagatcgtgccccagttccagcaactgacg	CRISPR spacer
accagatcggcccccagttccagcggacggaa	Protospacer
*********  *************.. .*. .

260. spacer 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP033769 (Acinetobacter baumannii strain FDAARGOS_533 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgtgcggaacaaaatataattccagagaa	CRISPR spacer
atacgtgaggaacaaaatataactcaggtaga	Protospacer
. ***** **************.** .* ..*

261. spacer 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT matches to CP042210 (Acinetobacter baumannii strain DS002 plasmid pTS134338, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgtgcggaacaaaatataattccagagaa	CRISPR spacer
atacgtgaggaacaaaatataactcaggtaga	Protospacer
. ***** **************.** .* ..*

262. spacer 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP038259 (Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgtgcggaacaaaatataattccagagaa	CRISPR spacer
atacgtgaggaacaaaatataactcaggtaga	Protospacer
. ***** **************.** .* ..*

263. spacer 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP038263 (Acinetobacter baumannii strain LEV1449/17Ec plasmid pEC_gr13, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgtgcggaacaaaatataattccagagaa	CRISPR spacer
atacgtgaggaacaaaatataactcaggtaga	Protospacer
. ***** **************.** .* ..*

264. spacer 2.15|2999136|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP022726 (Erwinia persicina strain B64 plasmid pEP1, complete sequence) position: , mismatch: 9, identity: 0.719

acaaagggaattaaaatgaacaaatcagtaat	CRISPR spacer
tcaaagggaattaataagaacaaaaatgggac	Protospacer
 ************* * *******   * .*.

265. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 9, identity: 0.719

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
gtctcaagcacatcagcaccggtacgggtatg	Protospacer
** ** ******************  . ..* 

266. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 9, identity: 0.719

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
gtctcaagcacatcagcaccggtacgggtatg	Protospacer
** ** ******************  . ..* 

267. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 9, identity: 0.719

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
gtctcaagcacatcagcaccggtacgggtatg	Protospacer
** ** ******************  . ..* 

268. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.719

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
tactccagcacgtccgcaccggtaacgatatc	Protospacer
   ********.** ***********. ..**

269. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.719

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
tactccagcacgtccgcaccggtaacgatatc	Protospacer
   ********.** ***********. ..**

270. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 9, identity: 0.719

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
tactccagcacgtccgcaccggtaacgatatc	Protospacer
   ********.** ***********. ..**

271. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.719

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
tactccagcacgtccgcaccggtaacgatatc	Protospacer
   ********.** ***********. ..**

272. spacer 2.20|2999441|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.719

gtatccagcacatcagcaccggtaacatcgtc	CRISPR spacer
tactccagcacgtccgcaccggtaacgatatc	Protospacer
   ********.** ***********. ..**

273. spacer 2.21|2999502|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP022107 (Halobacillus halophilus strain HL2HP6 plasmid pHL2HP62 sequence) position: , mismatch: 9, identity: 0.719

tgttgatggtaaagaggtggcggatattgatc	CRISPR spacer
aagatatggtaaagaggtggcggatcttcaga	Protospacer
 .   ******************** ** *  

274. spacer 2.21|2999502|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_017669 (Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence) position: , mismatch: 9, identity: 0.719

tgttgatggtaaagaggtggcggatattgatc	CRISPR spacer
aagatatggtaaagaggtggcggatcttcaga	Protospacer
 .   ******************** ** *  

275. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 9, identity: 0.719

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
ttgccggccagcgcctgtttctcgatgtcgct	Protospacer
 * .*.  .*********** *******.***

276. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 9, identity: 0.719

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
ttgccggccagcgcctgtttctcgatgtcgct	Protospacer
 * .*.  .*********** *******.***

277. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 9, identity: 0.719

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
ttgccggccagcgcctgtttctcgatgtcgct	Protospacer
 * .*.  .*********** *******.***

278. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
ttgccggccagcgcctgtttctcgatgtcgct	Protospacer
 * .*.  .*********** *******.***

279. spacer 2.25|2999746|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MF140428 (Mycobacterium phage Slimphazie, complete genome) position: , mismatch: 9, identity: 0.719

taaacagcgctgcagcggcgtttaactccgtg	CRISPR spacer
tgttcagcgcggcagcggcgttgaacttgcgg	Protospacer
*.  ****** *********** ****.   *

280. spacer 2.25|2999746|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN234231 (Mycobacterium phage Rapunzel97, complete genome) position: , mismatch: 9, identity: 0.719

taaacagcgctgcagcggcgtttaactccgtg	CRISPR spacer
tgttcagcgcggcagcggcgttgaacttgcgg	Protospacer
*.  ****** *********** ****.   *

281. spacer 2.25|2999746|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_023747 (Mycobacterium phage BarrelRoll, complete genome) position: , mismatch: 9, identity: 0.719

taaacagcgctgcagcggcgtttaactccgtg	CRISPR spacer
tgttcagcgcggcagcggcgttgaacttgcgg	Protospacer
*.  ****** *********** ****.   *

282. spacer 2.25|2999746|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH513977 (Mycobacterium phage Mynx, complete genome) position: , mismatch: 9, identity: 0.719

taaacagcgctgcagcggcgtttaactccgtg	CRISPR spacer
tgttcagcgcggcagcggcgttgaacttgcgg	Protospacer
*.  ****** *********** ****.   *

283. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 9, identity: 0.719

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
cttcgccagccattcctcgccgatgtccggca	Protospacer
 *   *..**** *************** **.

284. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 9, identity: 0.719

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
cttcgccagccattcctcgccgatgtccggca	Protospacer
 *   *..**** *************** **.

285. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN310545 (Mycobacterium phage Nitzel, complete genome) position: , mismatch: 9, identity: 0.719

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaattctcgccgaggtcctggg	Protospacer
.*.   .*******.******** ****** *

286. spacer 2.36|2998525|34|NZ_CP044177|PILER-CR matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 9, identity: 0.735

tcttttgat----tttgctgcgatgttatgaccagacg	CRISPR spacer
----tagacgtcgcttgctgcgacgatatgaccagacg	Protospacer
    * **.    .*********.* ************

287. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to MT786458 (Staphylococcus phage vB_SauH_SAP1, complete genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

288. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to MN304941 (Staphylococcus phage vB_SauH_IME522, complete genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

289. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to MG557618 (Staphylococcus phage HSA30, complete genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

290. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to KY779849 (Staphylococcus phage qdsa002, complete genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

291. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to MF001365 (Staphylococcus phage SA3, partial genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

292. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to MH159197 (Staphylococcus phage VB_SavM_JYL01, complete genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

293. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to MK250904 (Staphylococcus phage VB-SavM-JYL02, complete genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

294. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to KM216423 (Staphylococcus phage P108, complete genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

295. spacer 2.46|2999136|34|NZ_CP044177|PILER-CR matches to NC_019448 (Staphylococcus phage GH15, complete genome) position: , mismatch: 9, identity: 0.735

acaaagggaattaaaatgaacaaatcagtaatcg	CRISPR spacer
aaggaggaaattaaaatgaacaaagcagtagagc	Protospacer
* ..***.**************** *****.   

296. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MK972697 (Salmonella phage SF10, complete genome) position: , mismatch: 9, identity: 0.735

gtttcacgtagcgcctgtttgtcga-tgttgctcg	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcatgc-	Protospacer
 .*******************..** ***... * 

297. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MK972696 (Salmonella phage Si3 KFo-2019, complete genome) position: , mismatch: 9, identity: 0.735

gtttcacgtagcgcctgtttgtcga-tgttgctcg	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcatgc-	Protospacer
 .*******************..** ***... * 

298. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MK972695 (Salmonella phage SI5, complete genome) position: , mismatch: 9, identity: 0.735

gtttcacgtagcgcctgtttgtcga-tgttgctcg	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcatgc-	Protospacer
 .*******************..** ***... * 

299. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MK972688 (Salmonella phage SI8, complete genome) position: , mismatch: 9, identity: 0.735

gtttcacgtagcgcctgtttgtcga-tgttgctcg	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcatgc-	Protospacer
 .*******************..** ***... * 

300. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to MK972689 (Salmonella phage SF6, complete genome) position: , mismatch: 9, identity: 0.735

gtttcacgtagcgcctgtttgtcga-tgttgctcg	CRISPR spacer
tcttcacgtagcgcctgtttgctgattgtcatgc-	Protospacer
 .*******************..** ***... * 

301. spacer 2.55|2999685|34|NZ_CP044177|PILER-CR matches to NZ_CP017104 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872c, complete sequence) position: , mismatch: 9, identity: 0.735

gtagtcaggaccgctgacgcgttcgaaatcgtcg	CRISPR spacer
gctggcctctccgctgatgcgttcgacatcgtcg	Protospacer
*. * *    *******.******** *******

302. spacer 2.55|2999685|34|NZ_CP044177|PILER-CR matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.735

gtagtcaggaccgctgacgcgttcgaaatcgtcg	CRISPR spacer
gctggcctctccgctgatgcgttcgacatcgtcg	Protospacer
*. * *    *******.******** *******

303. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

304. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to KY012363 (Mycobacterium phage Empress, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

305. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MH669010 (Mycobacterium phage PHappiness, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

306. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MG872841 (Mycobacterium phage Priscilla, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

307. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MG962361 (Mycobacterium phage Alexphander, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

308. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

309. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MK016496 (Mycobacterium phage IrishSherpFalk, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

310. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MN735433 (Mycobacterium phage Scottish, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

311. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MH669014 (Mycobacterium phage Spikelee, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

312. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MG770213 (Mycobacterium phage OldBen, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

313. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MH669009 (Mycobacterium phage Nimbo, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

314. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MH632119 (Mycobacterium phage Harley, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

315. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MK112556 (Mycobacterium phage Zerg, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

316. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to KX576644 (Mycobacterium phage WillSterrel, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

317. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to KY702574 (Mycobacterium phage Kingsley, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

318. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to MN204502 (Mycobacterium phage KingMidas, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

319. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to NC_022068 (Mycobacteriophage Daenerys, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

320. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to JF937098 (Mycobacterium virus Ibhubesi, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

321. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to KT895281 (Mycobacterium phage Cabrinians, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

322. spacer 2.62|3000113|34|NZ_CP044177|PILER-CR matches to KX808131 (Mycobacterium phage SuperGrey, complete genome) position: , mismatch: 9, identity: 0.735

atggcctggccaatcctcgccgatgtcctgcgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgcgag	Protospacer
.*.   .********* ****** ******** *

323. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 9, identity: 0.719

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
gcgcagacgacggttgccggtgcgttgagcgc	Protospacer
* ***.**.**************** .  * .

324. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
ccgcagacgacggttgccggtgcgttgaccgc	Protospacer
  ***.**.**************** . ** .

325. spacer 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 9, identity: 0.719

gatgttatcaacgtcaacgttaaacgtgtcca	CRISPR spacer
tgccttatcaacgacaacgttaagcgtaacct	Protospacer
 .. ********* *********.***. ** 

326. spacer 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to MN364664 (Xanthomonas phage Xoo-sp15, complete genome) position: , mismatch: 9, identity: 0.719

gatgttatcaacgtcaacgttaaacgtgtcca	CRISPR spacer
gccactatcaacgtaaacgttaaaggtgatga	Protospacer
* ...********* ********* *** . *

327. spacer 3.22|3017753|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatctacgacaggctggcacccggcgaggaac	CRISPR spacer
cgtagaggacaggctggcgcccggcgatgagg	Protospacer
 .*  * ***********.******** **. 

328. spacer 3.22|3017753|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 9, identity: 0.719

gatctacgacaggctggcacccggcgaggaac	CRISPR spacer
cgtagaggacaggctggcgcccggcgatgagg	Protospacer
 .*  * ***********.******** **. 

329. spacer 3.22|3017753|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016290 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

gatctacgacaggctggcacccggcgaggaac	CRISPR spacer
cgtagaggacaggctggcgcccggcgatgagg	Protospacer
 .*  * ***********.******** **. 

330. spacer 2.7|2998647|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.688

agcggtgttctcaatacccacgacagccgccc	CRISPR spacer
tttttcgttctcaataccgacgacatccgtca	Protospacer
  .  .************ ****** ***.* 

331. spacer 2.11|2998892|32|NZ_CP044177|CRISPRCasFinder,CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 10, identity: 0.688

gaacgtgcggaacaaaatataattccagagaa	CRISPR spacer
tgacgtgcggaccaaaatagaattcgccgcac	Protospacer
 .********* ******* *****   . * 

332. spacer 2.22|2999563|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK672802 (Vibrio phage Va_90-11-286_p16, complete genome) position: , mismatch: 10, identity: 0.688

acctgtatcacctcgctaaaatctggcgcgaa	CRISPR spacer
tcaataatcacctcgctacaatatggcgcctc	Protospacer
 *    ************ *** ******   

333. spacer 2.22|2999563|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK672805 (Vibrio phage Va_PF430-3_p42, complete genome) position: , mismatch: 10, identity: 0.688

acctgtatcacctcgctaaaatctggcgcgaa	CRISPR spacer
tcaataatcacctcgctacaatatggcgcctc	Protospacer
 *    ************ *** ******   

334. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MT889397 (Mycobacterium phage OfUltron, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

335. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MF668281 (Mycobacterium phage RitaG, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

336. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MT889396 (Mycobacterium phage Seabastian, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

337. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK494110 (Mycobacterium phage SwagPigglett, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

338. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MT553345 (Mycobacterium phage LastJedi, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

339. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

340. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH669003 (Mycobacterium phage Girr, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

341. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK016504 (Mycobacterium phage Whouxphf, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

342. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH155865 (Mycobacterium phage BobaPhett, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

343. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH590598 (Mycobacterium phage Krakatau, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

344. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH651169 (Mycobacterium phage Burwell21, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

345. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MF668271 (Mycobacterium phage Geralt, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

346. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK359315 (Mycobacterium phage MisterCuddles, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

347. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_041855 (Mycobacterium phage Dorothy, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

348. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

349. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN586005 (Mycobacterium phage Lorde, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

350. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH651183 (Mycobacterium phage Nivrat, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

351. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MT553347 (Mycobacterium phage Awesomesauce, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

352. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN586012 (Mycobacterium phage Blexus, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

353. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK359307 (Mycobacterium phage Ochi17, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

354. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

355. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH651188 (Mycobacterium phage Ruby, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

356. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH590596 (Mycobacterium phage Mantra, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

357. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH834617 (Mycobacterium phage Lizziana, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

358. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_041988 (Mycobacterium phage ShiLan, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

359. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK524517 (Mycobacterium phage James, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

360. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

361. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KM066034 (Mycobacterium phage Inventum, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

362. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN586011 (Mycobacterium phage LilMoolah, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

363. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH399784 (Mycobacterium phage NormanBulbieJr, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

364. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MT310893 (Mycobacterium phage DRBy19, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

365. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

366. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

367. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH020243 (Mycobacterium phage TootsiePop, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

368. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN945900 (Mycobacterium phage BodEinwohner17, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

369. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_009820 (Mycobacterium phage Tweety, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

370. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MT114164 (Mycobacterium phage Veteran, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

371. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MF919526 (Mycobacterium phage Phasih, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

372. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN428051 (Mycobacterium phage Modragons, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

373. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_021301 (Mycobacterium phage SiSi, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

374. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_028923 (Mycobacterium phage Llama, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

375. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KY385384 (Mycobacterium phage SimranZ1, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

376. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_042315 (Mycobacterium virus RockyHorror, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

377. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MF919501 (Mycobacterium phage DaWorst, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

378. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN369751 (Mycobacterium phage TDanisky, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

379. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to JN542517 (Mycobacterium phage Drago, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

380. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MF668270 (Mycobacterium phage Emma, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

381. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH669005 (Mycobacterium phage JoeyJr, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

382. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH020242 (Mycobacterium phage Misha28, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

383. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH001448 (Mycobacterium phage UncleRicky, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

384. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_028654 (Mycobacterium phage Sparkdehlily, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

385. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN585975 (Mycobacterium phage Eish, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

386. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK875792 (Mycobacterium phage Polka14, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

387. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to KX610764 (Mycobacterium phage Kersh, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

388. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MN585987 (Mycobacterium phage Enby, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

389. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MH155871 (Mycobacterium phage Mattes, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

390. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to JN398368 (Mycobacterium virus GUmbie, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

391. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NC_028844 (Mycobacterium phage Phatniss, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

392. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to MK494120 (Mycobacterium phage Piper2020, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

393. spacer 2.31|3000113|32|NZ_CP044177|CRISPRCasFinder,CRT matches to FJ174692 (Mycobacterium phage Pacc40, complete genome) position: , mismatch: 10, identity: 0.688

atggcctggccaatcctcgccgatgtcctgcg	CRISPR spacer
gtacagcggccaatccgcgccgaggtcctgac	Protospacer
.*.   .********* ****** ******  

394. spacer 2.43|2998953|34|NZ_CP044177|PILER-CR matches to MK327941 (Escherichia phage vB_EcoM_G37-3, complete genome) position: , mismatch: 10, identity: 0.706

----tgcgacggaatgcacctggcgccagaaatattcg	CRISPR spacer
gtattgt----taatgcaactggcgccagtaatatttt	Protospacer
    **.     ****** ********** ******. 

395. spacer 2.43|2998953|34|NZ_CP044177|PILER-CR matches to MK327947 (Escherichia phage vB_EcoM_G5211, complete genome) position: , mismatch: 10, identity: 0.706

----tgcgacggaatgcacctggcgccagaaatattcg	CRISPR spacer
gtattgt----taatgcaactggcgccagtaatatttt	Protospacer
    **.     ****** ********** ******. 

396. spacer 2.51|2999441|34|NZ_CP044177|PILER-CR matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 10, identity: 0.706

gtatccagcacatcagcaccggtaacatcgtccg	CRISPR spacer
tactccagtacatcagcaccggtgacaatatcta	Protospacer
   *****.**************.*** ..**..

397. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 10, identity: 0.706

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
ttgccggccagcgcctgtttctcgatgtcgctct	Protospacer
 * .*.  .*********** *******.**** 

398. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 10, identity: 0.706

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
ttgccggccagcgcctgtttctcgatgtcgctct	Protospacer
 * .*.  .*********** *******.**** 

399. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 10, identity: 0.706

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
ttgccggccagcgcctgtttctcgatgtcgctct	Protospacer
 * .*.  .*********** *******.**** 

400. spacer 2.54|2999624|34|NZ_CP044177|PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

gtttcacgtagcgcctgtttgtcgatgttgctcg	CRISPR spacer
ttgccggccagcgcctgtttctcgatgtcgctct	Protospacer
 * .*.  .*********** *******.**** 

401. spacer 2.55|2999685|34|NZ_CP044177|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtcaggaccgctgacgcgttcgaaatcgtcg	CRISPR spacer
ggcgcggcttccgccgccgcgttcgaaatcgtcg	Protospacer
*  *. .   ****.* *****************

402. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 10, identity: 0.688

tgcgacccggccggaccgggcaccattaccac	CRISPR spacer
atcgacccggccggaacgggcgccaagggggc	Protospacer
  ************* *****.***  .  .*

403. spacer 3.5|3016717|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045421 (Maribius sp. THAF1 plasmid pTHAF1_a, complete sequence) position: , mismatch: 10, identity: 0.688

tgcgacccggccggaccgggcaccattaccac	CRISPR spacer
gacccaccggccggaccggacaccatcactgg	Protospacer
 .*   *************.******.**.. 

404. spacer 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to MK448236 (Klebsiella phage ST899-OXA48phi17.1, complete genome) position: , mismatch: 10, identity: 0.688

gatgttatcaacgtcaacgttaaacgtgtcca	CRISPR spacer
tgccttatcaacgacaacgttaagcgtaacgt	Protospacer
 .. ********* *********.***. *  

405. spacer 3.14|3017265|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 10, identity: 0.688

gatgttatcaacgtcaacgttaaacgtgtcca	CRISPR spacer
tgccttatcaacgacaacgttaagcgtaacgt	Protospacer
 .. ********* *********.***. *  

406. spacer 3.22|3017753|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to MH834627 (Arthrobacter phage Ryan, complete genome) position: , mismatch: 10, identity: 0.688

gatctacgacaggctggcacccggcgaggaac	CRISPR spacer
cgttgacgacaggctggcatcaggcgagctgg	Protospacer
 .*. **************.* ******  . 

407. spacer 3.23|3017814|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NC_015694 (Runella slithyformis DSM 19594 plasmid pRUNSL03, complete sequence) position: , mismatch: 10, identity: 0.688

agtgcgtttctgcgctcacgctcacgtgacag	CRISPR spacer
taagcgttcctgcgcttacgctcacgggcgta	Protospacer
 . *****.*******.********* *   .

408. spacer 2.12|2998953|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 11, identity: 0.656

tgcgacggaatgcacctggcgccagaaatatt	CRISPR spacer
aaggacggtattcacctggcgccagatcctca	Protospacer
 . ***** ** **************  . . 

409. spacer 2.23|2999624|32|NZ_CP044177|CRISPRCasFinder,CRT matches to NZ_CP010024 (Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence) position: , mismatch: 11, identity: 0.656

gtttcacgtagcgcctgtttgtcgatgttgct	CRISPR spacer
acgctcagtagcgcctctttgtcgatgctgag	Protospacer
.. ..  ********* **********.**  

410. spacer 2.35|2998464|34|NZ_CP044177|PILER-CR matches to NZ_CP034911 (Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

accagatcgtgccccagttccagcaactgacgcg	CRISPR spacer
accagatcggcccccagttccagcggacggaaga	Protospacer
*********  *************.. .*. . .

411. spacer 2.51|2999441|34|NZ_CP044177|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

gtatccagcacatcagcaccggtaacatcgtccg	CRISPR spacer
gtctcaagcacatcagcaccggtacgggtatgaa	Protospacer
** ** ******************  . ..*  .

412. spacer 2.51|2999441|34|NZ_CP044177|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

gtatccagcacatcagcaccggtaacatcgtccg	CRISPR spacer
gtctcaagcacatcagcaccggtacgggtatgaa	Protospacer
** ** ******************  . ..*  .

413. spacer 2.51|2999441|34|NZ_CP044177|PILER-CR matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

gtatccagcacatcagcaccggtaacatcgtccg	CRISPR spacer
gtctcaagcacatcagcaccggtacgggtatgaa	Protospacer
** ** ******************  . ..*  .

414. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 11, identity: 0.656

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
ccacaaacaaaggtttccggtgcgtacaaagg	Protospacer
  .******* **** **********      

415. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 11, identity: 0.656

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
ccacaaacaaaggtttccggtgcgtacaaagg	Protospacer
  .******* **** **********      

416. spacer 3.6|3016778|32|NZ_CP044177|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 11, identity: 0.656

gggcaaacaacggttgccggtgcgtaatccct	CRISPR spacer
ccacaaacaaaggtttccggtgcgtacaaagg	Protospacer
  .******* **** **********      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 637806 : 646950 8 Dickeya_phage(16.67%) integrase,transposase,protease NA
DBSCAN-SWA_2 984948 : 1071684 120 Enterobacteria_phage(49.51%) portal,integrase,plate,tRNA,protease,lysis,holin,head,tail,terminase,capsid attL 1032106:1032124|attR 1069238:1069256
DBSCAN-SWA_3 1291565 : 1297644 8 Enterobacteria_phage(100.0%) transposase,capsid NA
DBSCAN-SWA_4 1587640 : 1680570 112 Salmonella_phage(14.81%) transposase,integrase,plate,tRNA,head,protease,lysis,holin,tail,terminase attL 1582194:1582208|attR 1683243:1683257
DBSCAN-SWA_5 1788725 : 1796085 9 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_6 1953094 : 2023675 75 Cronobacter_phage(55.26%) portal,integrase,plate,tRNA,head,tail,terminase,capsid attL 1954606:1954626|attR 1983208:1983228
DBSCAN-SWA_7 2129208 : 2175992 50 Escherichia_phage(27.27%) integrase,transposase,protease attL 2142936:2142950|attR 2175874:2175888
DBSCAN-SWA_8 2192603 : 2338021 159 Escherichia_phage(38.1%) integrase,transposase attL 2274986:2275045|attR 2301406:2302225
DBSCAN-SWA_9 3350906 : 3405855 61 Cronobacter_phage(61.9%) portal,integrase,plate,tRNA,holin,head,tail,terminase,capsid attL 3368805:3368820|attR 3410503:3410518
DBSCAN-SWA_10 3445530 : 3504727 58 Escherichia_phage(18.18%) integrase,transposase,protease attL 3444428:3444487|attR 3458546:3459313
DBSCAN-SWA_11 4382444 : 4426953 46 Burkholderia_phage(42.86%) plate,tail,holin,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP044179
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33 : 34971 35 Escherichia_phage(97.14%) capsid,head,portal,holin,tail,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP044180
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 106239 130 Salmonella_phage(91.74%) tail,protease,terminase,portal,integrase attL 25207:25224|attR 77948:77965
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage