Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023692 Streptomyces vinaceus strain ATCC 27476 chromosome, complete genome 5 crisprs csa3,WYL,DEDDh,cas3,DinG,Cas9_archaeal,cas4 3 5 1 0

Results visualization

1. NZ_CP023692
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023692_1 3765413-3765479 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023692_2 4300289-4300375 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023692_3 4652204-4652296 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023692_4 5710899-5711807 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023692_5 7666129-7666217 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023692_4 4.14|5711730|21|NZ_CP023692|CRT 5711730-5711750 21 NZ_CP023692.1 5710767-5710787 1 0.952
NZ_CP023692_4 4.12|5711643|21|NZ_CP023692|CRT 5711643-5711663 21 NZ_CP023692.1 5710878-5710898 2 0.905
NZ_CP023692_4 4.12|5711643|21|NZ_CP023692|CRT 5711643-5711663 21 NZ_CP023692.1 5711841-5711861 2 0.905
NZ_CP023692_4 4.15|5711769|21|NZ_CP023692|CRT 5711769-5711789 21 NZ_CP023692.1 5710806-5710826 2 0.905

1. spacer 4.14|5711730|21|NZ_CP023692|CRT matches to position: 5710767-5710787, mismatch: 1, identity: 0.952 

tggcgaccgcccgtcgtaccc	CRISPR spacer
tggcgaccgtccgtcgtaccc	Protospacer
*********.***********

2. spacer 4.12|5711643|21|NZ_CP023692|CRT matches to position: 5710878-5710898, mismatch: 2, identity: 0.905 

cggcgaccgcccctcctaccc	CRISPR spacer
cggcgaccgtccgtcctaccc	Protospacer
*********.** ********

3. spacer 4.12|5711643|21|NZ_CP023692|CRT matches to position: 5711841-5711861, mismatch: 2, identity: 0.905 

cggcgaccgcccctcctaccc	CRISPR spacer
cggcgaccgtccgtcctaccc	Protospacer
*********.** ********

4. spacer 4.15|5711769|21|NZ_CP023692|CRT matches to position: 5710806-5710826, mismatch: 2, identity: 0.905 

cggtgggcgtccctcgtaccc	CRISPR spacer
cggtgggcgtccgtcctaccc	Protospacer
************ ** *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023692_4 4.7|5711343|24|NZ_CP023692|CRT 5711343-5711366 24 NC_047756 Caulobacter phage Sansa, complete genome 5983-6006 3 0.875
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 407658-407687 4 0.867
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 953302-953331 4 0.867
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 MN694209 Marine virus AFVG_250M582, complete genome 34898-34927 5 0.833
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 953302-953331 5 0.833
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 6451-6480 6 0.8
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 454370-454399 6 0.8
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_AP014686 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence 159580-159609 6 0.8
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 MN694209 Marine virus AFVG_250M582, complete genome 34898-34927 6 0.8
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 460570-460599 6 0.8
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP015380 Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence 20827-20856 6 0.8
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP015380 Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence 21208-21237 6 0.8
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP015380 Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence 23494-23523 6 0.8
NZ_CP023692_2 2.1|4300316|33|NZ_CP023692|CRISPRCasFinder 4300316-4300348 33 NC_010851 Streptomyces sp. FR1 plasmid pFRL1, complete sequence 27451-27483 7 0.788
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 924693-924722 7 0.767
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP023712 Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence 4471-4500 7 0.767
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 408416-408445 7 0.767
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP049837 Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence 74413-74442 7 0.767
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1434343-1434372 7 0.767
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP015380 Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence 20827-20856 7 0.767
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP015380 Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence 21208-21237 7 0.767
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP015380 Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence 23494-23523 7 0.767
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 767397-767426 7 0.767
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 403354-403383 7 0.767
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP045375 Sulfitobacter sp. THAF37 plasmid pTHAF37_c, complete sequence 49586-49615 7 0.767
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1119188-1119217 7 0.767
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1434343-1434372 7 0.767
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 362629-362658 7 0.767
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP045375 Sulfitobacter sp. THAF37 plasmid pTHAF37_c, complete sequence 49586-49615 7 0.767
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 460570-460599 7 0.767
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 MK016502 Mycobacterium phage Pat3, complete genome 16307-16336 7 0.767
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 MK016491 Mycobacterium phage BaboJay, complete genome 17131-17160 7 0.767
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP018077 Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence 35581-35610 7 0.767
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 187932-187961 8 0.733
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NC_010335 Caulobacter sp. K31 plasmid pCAUL01, complete sequence 16941-16970 8 0.733
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NC_023591 Mycobacterium phage Adler, complete genome 58220-58249 8 0.733
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 58218-58247 8 0.733
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 129053-129082 8 0.733
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 235587-235616 8 0.733
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1469151-1469180 8 0.733
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP018077 Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence 35581-35610 8 0.733
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP022371 Bosea sp. AS-1 plasmid unnamed2, complete sequence 42149-42178 8 0.733
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 MK016502 Mycobacterium phage Pat3, complete genome 16307-16336 8 0.733
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 MK016491 Mycobacterium phage BaboJay, complete genome 17131-17160 8 0.733
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1469151-1469180 8 0.733
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 767397-767426 8 0.733
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP022371 Bosea sp. AS-1 plasmid unnamed2, complete sequence 42149-42178 8 0.733
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1119188-1119217 8 0.733
NZ_CP023692_2 2.1|4300316|33|NZ_CP023692|CRISPRCasFinder 4300316-4300348 33 NC_023316 Streptomyces sp. 14R-10 plasmid pZL1, complete sequence 32146-32178 9 0.727
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 66823-66852 9 0.7
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 468767-468796 9 0.7
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 210838-210867 9 0.7
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 210838-210867 9 0.7
NZ_CP023692_2 2.1|4300316|33|NZ_CP023692|CRISPRCasFinder 4300316-4300348 33 NZ_CP017945 Phyllobacterium zundukense strain Tri-48 plasmid unnamed5, complete sequence 161173-161205 10 0.697
NZ_CP023692_4 4.6|5711295|30|NZ_CP023692|CRT 5711295-5711324 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 91736-91765 10 0.667
NZ_CP023692_4 4.10|5711523|30|NZ_CP023692|CRT 5711523-5711552 30 CP016641 Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence 105629-105658 10 0.667
NZ_CP023692_4 4.13|5711682|30|NZ_CP023692|CRT 5711682-5711711 30 CP016641 Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence 105629-105658 10 0.667

1. spacer 4.7|5711343|24|NZ_CP023692|CRT matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 3, identity: 0.875 

tggcgaccgcccgtccttcccgcg	CRISPR spacer
tcccgaccgcctgtccttcccgcg	Protospacer
*  ********.************

2. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 4, identity: 0.867 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
cggccggccttccggcggtggcggcggtgc	Protospacer
**.************.************ .

3. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 4, identity: 0.867 

-cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gcgag-gtctctccgttggcggcggcggtat	Protospacer
 **** ***.***** ************* *

4. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to MN694209 (Marine virus AFVG_250M582, complete genome) position: , mismatch: 5, identity: 0.833 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
ttggcgtccctccgatgggggcggcggtgt	Protospacer
* .***********.*** ********* *

5. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 5, identity: 0.833 

-tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gcgag-gtctctccgttggcggcggcggtat	Protospacer
 .*** ***.***** ************* *

6. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacc--ggccttccggtggtggcggcggttt	CRISPR spacer
--acctgcgccatccggtggtggcggcgatta	Protospacer
  ***   *** ****************.**

7. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacc--ggccttccggtggtggcggcggttt	CRISPR spacer
--acctgcgccatccggtggtggcggcgatta	Protospacer
  ***   *** ****************.**

8. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_AP014686 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacc--ggccttccggtggtggcggcggttt	CRISPR spacer
--acctgcgccatccggtggtggcggcgatta	Protospacer
  ***   *** ****************.**

9. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to MN694209 (Marine virus AFVG_250M582, complete genome) position: , mismatch: 6, identity: 0.8 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
ttggcgtccctccgatgggggcggcggtgt	Protospacer
. .***********.*** ********* *

10. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 6, identity: 0.8 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
cggccatccctccggcggcggcggcgtttc	Protospacer
**. *.*********.********** **.

11. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP015380 (Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tctgcgtctctccgggggcggcggcggtgc	Protospacer
*  *****.****** ************ .

12. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP015380 (Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tctgcgtctctccgggggcggcggcggtgc	Protospacer
*  *****.****** ************ .

13. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP015380 (Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tctgcgtctctccgggggcggcggcggtgc	Protospacer
*  *****.****** ************ .

14. spacer 2.1|4300316|33|NZ_CP023692|CRISPRCasFinder matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 7, identity: 0.788 

gggcgcagcggcagccccggccgtgaccccgat	CRISPR spacer
ggccagggcggcagccccggccgggaccgcgag	Protospacer
** *. .**************** **** ***

15. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 7, identity: 0.767 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
ccctgggccgtccggtggtggcggcggtca	Protospacer
*  . **** ******************.

16. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
cgctcggccttccgggggtggcggcgccaa	Protospacer
** .*********** ********** .

17. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.767 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
cggccggcgttccggtggtggcgatgagct	Protospacer
**.***** **************..*. .*

18. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP049837 (Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence) position: , mismatch: 7, identity: 0.767 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
gcacgccccttccagtggtggcggcggtct	Protospacer
  **   ******.**************.*

19. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gacgcggccccccggtggcggcggcggtgc	Protospacer
 . *** ***.***************** .

20. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP015380 (Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tctgcgtctctccgggggcggcggcggtgc	Protospacer
.  *****.****** ************ .

21. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP015380 (Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tctgcgtctctccgggggcggcggcggtgc	Protospacer
.  *****.****** ************ .

22. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP015380 (Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tctgcgtctctccgggggcggcggcggtgc	Protospacer
.  *****.****** ************ .

23. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
cgagcgtcccgccggtggcgccggagccgg	Protospacer
********** ********* *** * .

24. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.767 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tgggcgtccgtccggtggccgcggcgatcg	Protospacer
.*.****** ********* ******.*.

25. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP045375 (Sulfitobacter sp. THAF37 plasmid pTHAF37_c, complete sequence) position: , mismatch: 7, identity: 0.767 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
atagttgccctccggtggcgactgcggttt	Protospacer
  **.  *************.* *******

26. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
ccagcgtcactccggtgtcggcggccagct	Protospacer
* ****** ******** ******* . .*

27. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.767 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gacgcggccccccggtggcggcggcggtgc	Protospacer
 . *** ***.***************** .

28. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tgatcggccctccggtggcggcgcatagtt	Protospacer
*** ** ****************   . **

29. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP045375 (Sulfitobacter sp. THAF37 plasmid pTHAF37_c, complete sequence) position: , mismatch: 7, identity: 0.767 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
atagttgccctccggtggcgactgcggttt	Protospacer
  **.  *************.* *******

30. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.767 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
cggccatccctccggcggcggcggcgtttc	Protospacer
.*. *.*********.********** **.

31. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 7, identity: 0.767 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
ttccggttcgtccggtggcggcggcggtct	Protospacer
*    **.* ******************.*

32. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to MK016491 (Mycobacterium phage BaboJay, complete genome) position: , mismatch: 7, identity: 0.767 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
ttccggttcgtccggtggcggcggcggtct	Protospacer
*    **.* ******************.*

33. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tggcggtgcctccgatggcggcggcggtgg	Protospacer
**.  ** ******.*************

34. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
tcgccggccttccgatggcggcggcgggag	Protospacer
. .***********.***.********

35. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 8, identity: 0.733 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
tgctgggcattccggtggcggcggcggtcg	Protospacer
.* . *** *********.*********.

36. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 8, identity: 0.733 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
tggctcaggttccggtggtggcggtggttt	Protospacer
.*.*. .  ***************.*****

37. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 8, identity: 0.733 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
tggctcaggttccggtggtggcggtggttt	Protospacer
.*.*. .  ***************.*****

38. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
gtccggggcgtccggtggtggcggcggtcc	Protospacer
   * ** * ******************..

39. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.733 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
tggtcggcgtaccggtggtggcggcggcga	Protospacer
.*..**** * ****************.

40. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.733 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gtggcgctcctccggtggcggcggcggagg	Protospacer
  .***..*******************

41. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
tggcggtgcctccgatggcggcggcggtgg	Protospacer
.*.  ** ******.*************

42. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP022371 (Bosea sp. AS-1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gcagcggcccgccggtggcggcggccgccc	Protospacer
  **** *** ************** *...

43. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 8, identity: 0.733 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
ttccggttcgtccggtggcggcggcggtct	Protospacer
.    **.* ******************.*

44. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to MK016491 (Mycobacterium phage BaboJay, complete genome) position: , mismatch: 8, identity: 0.733 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
ttccggttcgtccggtggcggcggcggtct	Protospacer
.    **.* ******************.*

45. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.733 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gtggcgctcctccggtggcggcggcggagg	Protospacer
  .***..*******************

46. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
cgagcgtcccgccggtggcgccggagccgg	Protospacer
.********* ********* *** * .

47. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP022371 (Bosea sp. AS-1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gcagcggcccgccggtggcggcggccgccc	Protospacer
  **** *** ************** *...

48. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
ccagcgtcactccggtgtcggcggccagct	Protospacer
. ****** ******** ******* . .*

49. spacer 2.1|4300316|33|NZ_CP023692|CRISPRCasFinder matches to NC_023316 (Streptomyces sp. 14R-10 plasmid pZL1, complete sequence) position: , mismatch: 9, identity: 0.727 

---gggcgcagcggcagccccggccgtgaccccgat	CRISPR spacer
ttcgag---agcggcagccccggcggtgacgcctcg	Protospacer
   *.*   *************** ***** **

50. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
atgacggccttccgggggtggcgggggccg	Protospacer
  . *********** ******** **..

51. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 9, identity: 0.7 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
accccggccttccggtggtgctggcgaccg	Protospacer
   ***************** .****...

52. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
aacctgttccaccggtggcggcggcggtgg	Protospacer
 .  .**.** *****************

53. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
aacctgttccaccggtggcggcggcggtgg	Protospacer
 .  .**.** *****************

54. spacer 2.1|4300316|33|NZ_CP023692|CRISPRCasFinder matches to NZ_CP017945 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.697 

gggcgcagcggcagccccggccgtgaccccgat	CRISPR spacer
cgaggcagcggcacccctggccgtgaccatcgc	Protospacer
 *. ********* ***.********** . ..

55. spacer 4.6|5711295|30|NZ_CP023692|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.667 

cgaccggccttccggtggtggcggcggttt	CRISPR spacer
gccccggcctgccggtggtggcggtcccgc	Protospacer
   ******* *************.  . .

56. spacer 4.10|5711523|30|NZ_CP023692|CRT matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 10, identity: 0.667 

cgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gtcgcgtccctccggtggctgcggaatgag	Protospacer
   **************** **** .

57. spacer 4.13|5711682|30|NZ_CP023692|CRT matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 10, identity: 0.667 

tgagcgtccctccggtggcggcggcggttt	CRISPR spacer
gtcgcgtccctccggtggctgcggaatgag	Protospacer
   **************** **** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5740709 : 5746927 7 uncultured_Mediterranean_phage(16.67%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage