Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043501 Bacillus paralicheniformis strain A4-3 chromosome, complete genome 3 crisprs csa3,cas3,WYL,DinG,DEDDh 4 0 8 1
NZ_CP043503 Bacillus paralicheniformis strain A4-3 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP043502 Bacillus paralicheniformis strain A4-3 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP043501
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043501_1 3558621-3558719 Orphan NA
1 spacers
csa3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043501_2 3702213-3702428 Unclear NA
1 spacers
DinG,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043501_3 4369498-4369806 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP043501_3 3.4|4369639|21|NZ_CP043501|CRT 4369639-4369659 21 NZ_CP043501.1 4369807-4369827 0 1.0
NZ_CP043501_3 3.5|4369681|21|NZ_CP043501|CRT 4369681-4369701 21 NZ_CP043501.1 4369807-4369827 0 1.0
NZ_CP043501_3 3.6|4369723|21|NZ_CP043501|CRT 4369723-4369743 21 NZ_CP043501.1 4369807-4369827 0 1.0
NZ_CP043501_3 3.7|4369765|21|NZ_CP043501|CRT 4369765-4369785 21 NZ_CP043501.1 4369807-4369827 0 1.0

1. spacer 3.4|4369639|21|NZ_CP043501|CRT matches to position: 4369807-4369827, mismatch: 0, identity: 1.0

actttctcccttttcagctca	CRISPR spacer
actttctcccttttcagctca	Protospacer
*********************

2. spacer 3.5|4369681|21|NZ_CP043501|CRT matches to position: 4369807-4369827, mismatch: 0, identity: 1.0

actttctcccttttcagctca	CRISPR spacer
actttctcccttttcagctca	Protospacer
*********************

3. spacer 3.6|4369723|21|NZ_CP043501|CRT matches to position: 4369807-4369827, mismatch: 0, identity: 1.0

actttctcccttttcagctca	CRISPR spacer
actttctcccttttcagctca	Protospacer
*********************

4. spacer 3.7|4369765|21|NZ_CP043501|CRT matches to position: 4369807-4369827, mismatch: 0, identity: 1.0

actttctcccttttcagctca	CRISPR spacer
actttctcccttttcagctca	Protospacer
*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1857538 : 1913969 81 Bacillus_phage(24.49%) terminase,capsid,plate,integrase,tRNA,tail,protease,holin,portal attL 1867772:1867788|attR 1920119:1920135
DBSCAN-SWA_2 1989180 : 1999105 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 2229905 : 2294192 80 Bacillus_phage(42.86%) head,terminase,portal,capsid,plate,integrase,transposase,tRNA,tail,holin,coat,protease attL 2229867:2229889|attR 2272007:2272029
DBSCAN-SWA_4 2624213 : 2699697 95 uncultured_Caudovirales_phage(25.64%) terminase,capsid,plate,tail,holin,coat,portal NA
DBSCAN-SWA_5 2772542 : 2853074 104 Bacillus_phage(30.43%) head,terminase,capsid,integrase,transposase,tail,protease,holin,portal attL 2766314:2766329|attR 2821976:2821991
DBSCAN-SWA_6 3804894 : 3816538 14 Staphylococcus_phage(55.56%) NA NA
DBSCAN-SWA_7 4001077 : 4056254 79 Bacillus_phage(32.5%) terminase,capsid,plate,integrase,tail,holin,coat,portal attL 4012498:4012512|attR 4042813:4042827
DBSCAN-SWA_8 4327008 : 4383953 60 Bacillus_phage(36.36%) tRNA,transposase,coat,protease NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP043501.1|WP_003183993.1|4339351_4339531_+|hypothetical-protein 4339351_4339531_+ 59 aa aa NA NA NA 4327008-4383953 yes