Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031067 Bacillus sp. SH8-8 plasmid pl5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031066 Bacillus sp. SH8-8 plasmid pl193, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP031065 Bacillus sp. SH8-8 chromosome, complete genome 3 crisprs cas3,csa3,WYL,DinG,cas14k,cas14j,DEDDh 0 3 7 0

Results visualization

1. NZ_CP031065
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031065_1 3142831-3143471 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031065_2 4606199-4606306 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031065_3 5026052-5026185 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031065_1 1.6|3143256|25|NZ_CP031065|CRT 3143256-3143280 25 MT774376 CrAssphage cr55_1, complete genome 95986-96010 4 0.84
NZ_CP031065_3 3.1|5026075|31|NZ_CP031065|CRISPRCasFinder 5026075-5026105 31 JX238501 Bacillus phage phiAGATE, complete genome 124559-124589 8 0.742
NZ_CP031065_1 1.8|3143364|34|NZ_CP031065|CRT 3143364-3143397 34 MT820023 Cryophage ML09, complete genome 23671-23704 12 0.647

1. spacer 1.6|3143256|25|NZ_CP031065|CRT matches to MT774376 (CrAssphage cr55_1, complete genome) position: , mismatch: 4, identity: 0.84

cattactccttgtggtccttgaatt	CRISPR spacer
aggttctccttgtggtccttgaatt	Protospacer
 . * ********************

2. spacer 3.1|5026075|31|NZ_CP031065|CRISPRCasFinder matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.742

ttcttcttttttgtcactagttgaaccgctt	CRISPR spacer
ctaaccttttttgccactagttaaaccgccc	Protospacer
.*  .********.********.******..

3. spacer 1.8|3143364|34|NZ_CP031065|CRT matches to MT820023 (Cryophage ML09, complete genome) position: , mismatch: 12, identity: 0.647

ggttgggcctatacttccttgtggtccctgaata	CRISPR spacer
ttgtgcgcctgtacttccttgtggtcctacgggg	Protospacer
   ** ****.****************.  .. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 256670 : 264619 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 310195 : 318571 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 649212 : 657209 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_4 1798969 : 1807075 7 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 2429501 : 2472074 54 Bacillus_phage(60.53%) portal,integrase,head,capsid,terminase,tail,bacteriocin,holin,protease attL 2424790:2424805|attR 2458995:2459010
DBSCAN-SWA_6 3514195 : 3524368 14 Bacillus_phage(54.55%) bacteriocin NA
DBSCAN-SWA_7 4311663 : 4319350 9 Staphylococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage