Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042999 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042998 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042997 Aquisphaera giovannonii strain OJF2 chromosome, complete genome 30 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2,RT,csa3,DEDDh,WYL,PD-DExK,DinG 5 29 7 0

Results visualization

1. NZ_CP042997
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_1 353690-353797 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_2 453114-453674 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_3 546619-546968 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_4 601016-601098 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_5 627310-627412 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_6 779295-783595 TypeI I-C
64 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_7 1020312-1020409 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_8 1554603-1554685 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_9 1845285-1845408 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_10 1900215-1900612 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_11 2094029-2094182 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_12 2244964-2245070 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_13 4037886-4037982 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_14 4445320-4445685 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_15 4902934-4903034 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_16 4959267-4959365 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_17 4962421-4962566 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_18 5102000-5102104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_19 5199241-5199340 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_20 5327316-5327428 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_21 5740905-5741031 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_22 5825619-5825749 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_23 6013036-6013141 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_24 7007785-7007908 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_25 8357450-8357547 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_26 9179229-9179327 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_27 9331219-9331320 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_28 9400035-9400132 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_29 9726696-9726797 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042997_30 10311366-10311572 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP042997_1 1.1|353727|34|NZ_CP042997|CRISPRCasFinder 353727-353760 34 NZ_CP042997.1 8923791-8923824 0 1.0
NZ_CP042997_25 25.1|8357476|46|NZ_CP042997|CRISPRCasFinder 8357476-8357521 46 NZ_CP042997.1 8357547-8357592 0 1.0
NZ_CP042997_11 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder 2094099-2094115 17 NZ_CP042997.1 5044703-5044719 1 0.941
NZ_CP042997_11 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder 2094099-2094115 17 NZ_CP042997.1 5791467-5791483 1 0.941
NZ_CP042997_11 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder 2094099-2094115 17 NZ_CP042997.1 412069-412085 1 0.941
NZ_CP042997_11 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder 2094099-2094115 17 NZ_CP042997.1 4387813-4387829 1 0.941
NZ_CP042997_11 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder 2094099-2094115 17 NZ_CP042997.1 5859138-5859154 1 0.941
NZ_CP042997_11 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder 2094099-2094115 17 NZ_CP042997.1 8720923-8720939 1 0.941
NZ_CP042997_11 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder 2094099-2094115 17 NZ_CP042997.1 9077483-9077499 1 0.941
NZ_CP042997_15 15.1|4902959|51|NZ_CP042997|CRISPRCasFinder 4902959-4903009 51 NZ_CP042997.1 4902997-4903047 1 0.98
NZ_CP042997_20 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder 5327357-5327387 31 NZ_CP042997.1 5327429-5327459 1 0.968

1. spacer 1.1|353727|34|NZ_CP042997|CRISPRCasFinder matches to position: 8923791-8923824, mismatch: 0, identity: 1.0

cccagcagcgagacgatgaacgagtgccggcggg	CRISPR spacer
cccagcagcgagacgatgaacgagtgccggcggg	Protospacer
**********************************

2. spacer 25.1|8357476|46|NZ_CP042997|CRISPRCasFinder matches to position: 8357547-8357592, mismatch: 0, identity: 1.0

aaccctcggggtcaggtcatgtttttggttttttcggggactggca	CRISPR spacer
aaccctcggggtcaggtcatgtttttggttttttcggggactggca	Protospacer
**********************************************

3. spacer 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder matches to position: 5044703-5044719, mismatch: 1, identity: 0.941

gcccccgcgccggccgt	CRISPR spacer
gcccccgcgccggtcgt	Protospacer
*************.***

4. spacer 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder matches to position: 5791467-5791483, mismatch: 1, identity: 0.941

gcccccgcgccggccgt	CRISPR spacer
gcccccgcgcgggccgt	Protospacer
********** ******

5. spacer 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder matches to position: 412069-412085, mismatch: 1, identity: 0.941

gcccccgcgccggccgt	CRISPR spacer
gccccggcgccggccgt	Protospacer
***** ***********

6. spacer 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder matches to position: 4387813-4387829, mismatch: 1, identity: 0.941

gcccccgcgccggccgt	CRISPR spacer
gcccccgcgcccgccgt	Protospacer
*********** *****

7. spacer 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder matches to position: 5859138-5859154, mismatch: 1, identity: 0.941

gcccccgcgccggccgt	CRISPR spacer
gcccccacgccggccgt	Protospacer
******.**********

8. spacer 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder matches to position: 8720923-8720939, mismatch: 1, identity: 0.941

gcccccgcgccggccgt	CRISPR spacer
gcccccgcgccgggcgt	Protospacer
************* ***

9. spacer 11.2|2094099|17|NZ_CP042997|CRISPRCasFinder matches to position: 9077483-9077499, mismatch: 1, identity: 0.941

gcccccgcgccggccgt	CRISPR spacer
gcccccgcgccgaccgt	Protospacer
************.****

10. spacer 15.1|4902959|51|NZ_CP042997|CRISPRCasFinder matches to position: 4902997-4903047, mismatch: 1, identity: 0.98

gcaatctcgtagtgtgggtcagcgaagcgcagcccaccgcaatctcgtagg	CRISPR spacer
gcaatctcgtagggtgggtcagcgaagcgcagcccaccgcaatctcgtagg	Protospacer
************ **************************************

11. spacer 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder matches to position: 5327429-5327459, mismatch: 1, identity: 0.968

tcgtcccggcggccgggcgagcctgggaggc	CRISPR spacer
tcgtcccggcgaccgggcgagcctgggaggc	Protospacer
***********.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042997_3 3.2|546705|23|NZ_CP042997|CRT 546705-546727 23 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 52007-52029 2 0.913
NZ_CP042997_3 3.2|546705|23|NZ_CP042997|CRT 546705-546727 23 KT351734 Pectobacterium carotovorum plasmid Drgb3, complete sequence 149459-149481 2 0.913
NZ_CP042997_3 3.3|546747|23|NZ_CP042997|CRT 546747-546769 23 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 1171-1193 2 0.913
NZ_CP042997_3 3.3|546747|23|NZ_CP042997|CRT 546747-546769 23 NZ_CP019604 Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence 120888-120910 2 0.913
NZ_CP042997_3 3.2|546705|23|NZ_CP042997|CRT 546705-546727 23 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 719130-719152 3 0.87
NZ_CP042997_3 3.2|546705|23|NZ_CP042997|CRT 546705-546727 23 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 439385-439407 3 0.87
NZ_CP042997_4 4.1|601045|25|NZ_CP042997|CRISPRCasFinder 601045-601069 25 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 1079716-1079740 3 0.88
NZ_CP042997_10 10.11|1900449|23|NZ_CP042997|CRT 1900449-1900471 23 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 324232-324254 3 0.87
NZ_CP042997_4 4.1|601045|25|NZ_CP042997|CRISPRCasFinder 601045-601069 25 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 1085199-1085223 4 0.84
NZ_CP042997_4 4.1|601045|25|NZ_CP042997|CRISPRCasFinder 601045-601069 25 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 739030-739054 4 0.84
NZ_CP042997_8 8.1|1554632|25|NZ_CP042997|CRISPRCasFinder 1554632-1554656 25 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 27379-27403 4 0.84
NZ_CP042997_10 10.6|1900505|28|NZ_CP042997|CRISPRCasFinder 1900505-1900532 28 NZ_CP041355 Pseudomonas aeruginosa strain AZPAE15042 plasmid pIHMA87, complete sequence 146619-146646 5 0.821
NZ_CP042997_10 10.6|1900505|28|NZ_CP042997|CRISPRCasFinder 1900505-1900532 28 NZ_LT969521 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 2 119221-119248 5 0.821
NZ_CP042997_10 10.6|1900505|28|NZ_CP042997|CRISPRCasFinder 1900505-1900532 28 NZ_CP052760 Pseudomonas aeruginosa strain LYT4 plasmid unnamed1, complete sequence 20368-20395 5 0.821
NZ_CP042997_20 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder 5327357-5327387 31 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 269439-269469 5 0.839
NZ_CP042997_29 29.1|9726732|30|NZ_CP042997|CRISPRCasFinder 9726732-9726761 30 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 518886-518915 5 0.833
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1062261-1062294 6 0.824
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 MK894438 Microbacterium phage LilyLou, complete genome 9809-9842 6 0.824
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 MK308638 Microbacterium phage ArMaWen, complete genome 9432-9465 6 0.824
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 NC_048778 Microbacterium phage Alex44, complete genome 9632-9665 6 0.824
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 479785-479818 6 0.824
NZ_CP042997_10 10.3|1900343|28|NZ_CP042997|CRISPRCasFinder 1900343-1900370 28 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 99908-99935 6 0.786
NZ_CP042997_10 10.3|1900343|28|NZ_CP042997|CRISPRCasFinder 1900343-1900370 28 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 99415-99442 6 0.786
NZ_CP042997_10 10.3|1900343|28|NZ_CP042997|CRISPRCasFinder 1900343-1900370 28 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 43989-44016 6 0.786
NZ_CP042997_10 10.3|1900343|28|NZ_CP042997|CRISPRCasFinder 1900343-1900370 28 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 60515-60542 6 0.786
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 68235-68268 7 0.794
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 MT310887 Microbacterium phage Unphazed, complete genome 9668-9701 7 0.794
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 NZ_CP021375 Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence 57822-57855 7 0.794
NZ_CP042997_6 6.15|780268|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780268-780302 35 NZ_CP045223 Achromobacter xylosoxidans strain DN002 plasmid unnamed 231205-231239 7 0.8
NZ_CP042997_6 6.60|783263|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 783263-783296 34 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 304124-304157 7 0.794
NZ_CP042997_20 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder 5327357-5327387 31 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 289967-289997 7 0.774
NZ_CP042997_20 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder 5327357-5327387 31 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 407074-407104 7 0.774
NZ_CP042997_20 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder 5327357-5327387 31 MN908687 Gordonia phage Skog, complete genome 143234-143264 7 0.774
NZ_CP042997_6 6.5|779598|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779598-779632 35 NZ_CP013918 Sphingomonas sp. LK11 plasmid unnamed1, complete sequence 15447-15481 8 0.771
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP029602 Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence 23379-23412 8 0.765
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NC_020910 Octadecabacter arcticus 238 plasmid pOA238_160, complete sequence 133767-133800 8 0.765
NZ_CP042997_6 6.17|780403|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780403-780436 34 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 564266-564299 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1674385-1674418 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 58589-58622 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 67894-67927 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 319999-320032 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1357515-1357548 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 856687-856720 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 221205-221238 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 200344-200377 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1564992-1565025 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1674400-1674433 8 0.765
NZ_CP042997_6 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781337-781370 34 MK249160 Blackfly microvirus SF02 isolate 073, complete genome 781-814 8 0.765
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 KY555144 Caulobacter phage Ccr5, complete genome 193474-193506 8 0.758
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NC_019411 Caulobacter phage CcrSwift, complete genome 193549-193581 8 0.758
NZ_CP042997_20 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder 5327357-5327387 31 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 458431-458461 8 0.742
NZ_CP042997_20 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder 5327357-5327387 31 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 58117-58147 8 0.742
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NC_028791 Mycobacterium phage MOOREtheMARYer, complete genome 15428-15461 9 0.735
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 72252-72285 9 0.735
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 631841-631874 9 0.735
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 256587-256620 9 0.735
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 98374-98407 9 0.735
NZ_CP042997_6 6.14|780200|36|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780200-780235 36 MH067975 Arthrobacter sp. strain ANT_H58 plasmid pA58H2, complete sequence 36836-36871 9 0.75
NZ_CP042997_6 6.18|780469|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780469-780503 35 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 749776-749810 9 0.743
NZ_CP042997_6 6.19|780536|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780536-780569 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 782394-782427 9 0.735
NZ_CP042997_6 6.27|781070|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781070-781103 34 NC_009956 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence 14019-14052 9 0.735
NZ_CP042997_6 6.27|781070|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781070-781103 34 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 506162-506195 9 0.735
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NZ_CP015032 Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence 19171-19203 9 0.727
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NZ_CP015271 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 4, complete sequence 10513-10545 9 0.727
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NZ_CP015277 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 5, complete sequence 13212-13244 9 0.727
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NZ_CP012888 Mycobacterium chimaera strain AH16 plasmid unnamed3, complete sequence 1283-1315 9 0.727
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NZ_CP022225 Mycobacterium chimaera strain SJ42 plasmid unnamed2, complete sequence 9888-9920 9 0.727
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 176005-176037 9 0.727
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NZ_AP020329 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p3-JPH1, complete sequence 11976-12008 9 0.727
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 NZ_CP045968 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_05, complete sequence 6867-6899 9 0.727
NZ_CP042997_6 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781933-781966 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 906286-906319 9 0.735
NZ_CP042997_6 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781933-781966 34 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 674522-674555 9 0.735
NZ_CP042997_6 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781933-781966 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 906293-906326 9 0.735
NZ_CP042997_6 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781933-781966 34 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1177908-1177941 9 0.735
NZ_CP042997_6 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781933-781966 34 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1177853-1177886 9 0.735
NZ_CP042997_6 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781933-781966 34 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 666486-666519 9 0.735
NZ_CP042997_6 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781933-781966 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1219916-1219949 9 0.735
NZ_CP042997_6 6.41|781999|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781999-782033 35 NC_015685 Oligotropha carboxidovorans OM5 plasmid pOC167, complete sequence 14547-14581 9 0.743
NZ_CP042997_6 6.41|781999|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781999-782033 35 NC_007960 Nitrobacter hamburgensis X14 plasmid 2, complete sequence 33662-33696 9 0.743
NZ_CP042997_6 6.46|782332|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 782332-782365 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 83057-83090 9 0.735
NZ_CP042997_6 6.46|782332|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 782332-782365 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 622870-622903 9 0.735
NZ_CP042997_6 6.46|782332|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 782332-782365 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 81618-81651 9 0.735
NZ_CP042997_6 6.46|782332|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 782332-782365 34 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 88050-88083 9 0.735
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1067961-1067994 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1817235-1817268 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1900566-1900599 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1719617-1719650 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1789832-1789865 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1718639-1718672 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1810347-1810380 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1810349-1810382 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1719610-1719643 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1718931-1718964 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1719599-1719632 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1817415-1817448 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1817413-1817446 10 0.706
NZ_CP042997_6 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779869-779902 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1817381-1817414 10 0.706
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1229608-1229641 10 0.706
NZ_CP042997_6 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 779935-779968 34 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 381001-381034 10 0.706
NZ_CP042997_6 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780067-780100 34 MT657336 Microbacterium phage ClearAsMud, complete genome 15952-15985 10 0.706
NZ_CP042997_6 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780067-780100 34 MH155873 Microbacterium phage Paschalis, complete genome 15208-15241 10 0.706
NZ_CP042997_6 6.16|780335|36|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780335-780370 36 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 532085-532120 10 0.722
NZ_CP042997_6 6.17|780403|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780403-780436 34 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 663507-663540 10 0.706
NZ_CP042997_6 6.17|780403|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780403-780436 34 NZ_CP030863 Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence 23799-23832 10 0.706
NZ_CP042997_6 6.34|781536|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781536-781569 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 249350-249383 10 0.706
NZ_CP042997_6 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781602-781634 33 KY940711 Bradyrhizobium phage BDU-MI-1, complete genome 18196-18228 10 0.697
NZ_CP042997_6 6.36|781667|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 781667-781701 35 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 4312-4346 10 0.714
NZ_CP042997_6 6.50|782598|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 782598-782632 35 NZ_CP018080 Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence 9142-9176 10 0.714
NZ_CP042997_6 6.60|783263|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 783263-783296 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 1023990-1024023 10 0.706
NZ_CP042997_6 6.60|783263|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 783263-783296 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 27607-27640 10 0.706
NZ_CP042997_6 6.60|783263|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 783263-783296 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 680230-680263 10 0.706
NZ_CP042997_6 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780067-780100 34 MN175603 Microbacterium phage Tyrumbra, complete genome 14428-14461 11 0.676
NZ_CP042997_6 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780067-780100 34 MN585986 Microbacterium phage Ariadne, complete genome 17177-17210 11 0.676
NZ_CP042997_6 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780067-780100 34 MN586007 Microbacterium phage Smarties, complete genome 17177-17210 11 0.676
NZ_CP042997_6 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780067-780100 34 MH271312 Microbacterium phage RobsFeet, complete genome 15352-15385 11 0.676
NZ_CP042997_6 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780067-780100 34 MK524510 Microbacterium phage Fireman, complete genome 15085-15118 11 0.676
NZ_CP042997_6 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT 780067-780100 34 NC_047988 Microbacterium phage Metamorphoo, complete genome 15071-15104 11 0.676

1. spacer 3.2|546705|23|NZ_CP042997|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 2, identity: 0.913

gacgggatcatgccgccgctgga	CRISPR spacer
gccgcgatcatgccgccgctgga	Protospacer
* ** ******************

2. spacer 3.2|546705|23|NZ_CP042997|CRT matches to KT351734 (Pectobacterium carotovorum plasmid Drgb3, complete sequence) position: , mismatch: 2, identity: 0.913

gacgggatcatgccgccgctgga	CRISPR spacer
gacgggataatgcagccgctgga	Protospacer
******** **** *********

3. spacer 3.3|546747|23|NZ_CP042997|CRT matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 2, identity: 0.913

ccgtggtgcttcttcaggaaccc	CRISPR spacer
tcgtggtgcttcttcatgaaccc	Protospacer
.*************** ******

4. spacer 3.3|546747|23|NZ_CP042997|CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 2, identity: 0.913

ccgtggtgcttcttcaggaaccc	CRISPR spacer
tcgtggtgcttcttcatgaaccc	Protospacer
.*************** ******

5. spacer 3.2|546705|23|NZ_CP042997|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 3, identity: 0.87

gacgggatcatgccgccgctgga	CRISPR spacer
cgcggcatcatgccgccgctgga	Protospacer
 .*** *****************

6. spacer 3.2|546705|23|NZ_CP042997|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.87

gacgggatcatgccgccgctgga	CRISPR spacer
cgcgggatcatgccgccggtgga	Protospacer
 .**************** ****

7. spacer 4.1|601045|25|NZ_CP042997|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 3, identity: 0.88

acggggcaacgcgacggccggggcc	CRISPR spacer
accgggcaacgcgacggtcggggcg	Protospacer
** **************.****** 

8. spacer 10.11|1900449|23|NZ_CP042997|CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 3, identity: 0.87

tagtacaggaccggatcattcag	CRISPR spacer
tagtacaggaccggatcatcgat	Protospacer
*******************. * 

9. spacer 4.1|601045|25|NZ_CP042997|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.84

acggggcaacgcgacggccggggcc	CRISPR spacer
gggggccgacgcgacggccggggcc	Protospacer
. *** *.*****************

10. spacer 4.1|601045|25|NZ_CP042997|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 4, identity: 0.84

acggggcaacgcgacggccggggcc	CRISPR spacer
cggcggcagcgcgacggccggggcc	Protospacer
  * ****.****************

11. spacer 8.1|1554632|25|NZ_CP042997|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 4, identity: 0.84

acggggaataccgccggcggagccc	CRISPR spacer
caggggaataccgcccgtggagccc	Protospacer
  ************* *.*******

12. spacer 10.6|1900505|28|NZ_CP042997|CRISPRCasFinder matches to NZ_CP041355 (Pseudomonas aeruginosa strain AZPAE15042 plasmid pIHMA87, complete sequence) position: , mismatch: 5, identity: 0.821

atagaggccggggctgaagtcgtacatc	CRISPR spacer
cgagcggctggggctgaagtcgtacacc	Protospacer
  ** ***.*****************.*

13. spacer 10.6|1900505|28|NZ_CP042997|CRISPRCasFinder matches to NZ_LT969521 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 2) position: , mismatch: 5, identity: 0.821

atagaggccggggctgaagtcgtacatc	CRISPR spacer
cgagcggctggggctgaagtcgtacacc	Protospacer
  ** ***.*****************.*

14. spacer 10.6|1900505|28|NZ_CP042997|CRISPRCasFinder matches to NZ_CP052760 (Pseudomonas aeruginosa strain LYT4 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

atagaggccggggctgaagtcgtacatc	CRISPR spacer
cgagcggctggggctgaagtcgtacacc	Protospacer
  ** ***.*****************.*

15. spacer 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.839

tcgtcccggcggccgggcgagcctgggaggc	CRISPR spacer
tcgtcccggcggccgggcgcgccgccgcggc	Protospacer
******************* ***   * ***

16. spacer 29.1|9726732|30|NZ_CP042997|CRISPRCasFinder matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 5, identity: 0.833

ttcggtcttctcttcccctcgtctc-tgtgt	CRISPR spacer
tgcagtcttcttttcccctcgtctcacgtg-	Protospacer
* *.*******.************* .*** 

17. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.824

gccgcgccggcgtccgggtccgcctcg-ctggtcg	CRISPR spacer
gccgcgccggcatccgcgtccgccaggcctcgtc-	Protospacer
***********.**** *******  * ** *** 

18. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MK894438 (Microbacterium phage LilyLou, complete genome) position: , mismatch: 6, identity: 0.824

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
gacccagaccagctcgccgtcttcgccacgacgc	Protospacer
*.* ..******.******************** 

19. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MK308638 (Microbacterium phage ArMaWen, complete genome) position: , mismatch: 6, identity: 0.824

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
gacccagaccagctcgccgtcttcgccacgacgc	Protospacer
*.* ..******.******************** 

20. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_048778 (Microbacterium phage Alex44, complete genome) position: , mismatch: 6, identity: 0.824

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
gacccagaccagctcgccgtcttcgccacgacgc	Protospacer
*.* ..******.******************** 

21. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.824

caggccgcgaacgccatcggcgccacccgcctgg---	CRISPR spacer
gaggccgcgaccgccatcggcaccac---cctggacg	Protospacer
 ********* **********.****   *****   

22. spacer 10.3|1900343|28|NZ_CP042997|CRISPRCasFinder matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 6, identity: 0.786

ccggagcccccgacttcggttgtacagc	CRISPR spacer
agggagccgccgactttggttgtacgcc	Protospacer
  ****** *******.********. *

23. spacer 10.3|1900343|28|NZ_CP042997|CRISPRCasFinder matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 6, identity: 0.786

ccggagcccccgacttcggttgtacagc	CRISPR spacer
agggagccgccgactttggttgtacgcc	Protospacer
  ****** *******.********. *

24. spacer 10.3|1900343|28|NZ_CP042997|CRISPRCasFinder matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 6, identity: 0.786

ccggagcccccgacttcggttgtacagc	CRISPR spacer
agggagccgccgactttggttgtacgcc	Protospacer
  ****** *******.********. *

25. spacer 10.3|1900343|28|NZ_CP042997|CRISPRCasFinder matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 6, identity: 0.786

ccggagcccccgacttcggttgtacagc	CRISPR spacer
agggagccgccgactttggttgtacgcc	Protospacer
  ****** *******.********. *

26. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.794

gccgcgccggcgtccgggtccgcctcgctggtcg-	CRISPR spacer
accgagccggcgtccgggtccgtct-gcgcctcga	Protospacer
.*** *****************.** **   *** 

27. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MT310887 (Microbacterium phage Unphazed, complete genome) position: , mismatch: 7, identity: 0.794

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
gacccagaccagctcaccgtcttcgccacgacgc	Protospacer
*.* ..******.**.***************** 

28. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021375 (Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence) position: , mismatch: 7, identity: 0.794

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
ggagacggcaagttcgccgtcttcaccccgacgg	Protospacer
** *  *.* **************.** ******

29. spacer 6.15|780268|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 7, identity: 0.8

--tcgtttccgtcgccgggtcgatcatctccgcgaca	CRISPR spacer
ggtcg--tcaatcgccggctcaatcatctccgcgacc	Protospacer
  ***  ** .******* **.************** 

30. spacer 6.60|783263|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

-gtctcgatcctcgcccgctccctcgccccggccg	CRISPR spacer
agcgacga-ccacgcccggtccctcgccccggcgg	Protospacer
 *.  *** ** ****** ************** *

31. spacer 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

tcgtcccggcggccgggcgagcctgggaggc	CRISPR spacer
ctctctcggcggccgggcgagcctgagggcc	Protospacer
.. **.*******************.*.* *

32. spacer 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 7, identity: 0.774

tcgtcccggcggccgggcgagcctgggaggc	CRISPR spacer
ttgacccggtggccgggcgagcccgggtgct	Protospacer
*.* *****.*************.*** * .

33. spacer 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 7, identity: 0.774

tcgtcccggcggccgggcgagcctgggaggc	CRISPR spacer
gggtctcggcggccaggcgagcctgctcggc	Protospacer
  ***.********.**********   ***

34. spacer 6.5|779598|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013918 (Sphingomonas sp. LK11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.771

tcggcggccctccgcagcccgaccgtcccctcccc	CRISPR spacer
ggggcggcccgccgcagcccgaccgaccaccacgc	Protospacer
  ******** ************** ** *. * *

35. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
acggccccggcgcccgggtccgcctcgccgacgg	Protospacer
.* ** ******.***************.*.. *

36. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_020910 (Octadecabacter arcticus 238 plasmid pOA238_160, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccg-gcgtccgggtccgcctcgctggtcg	CRISPR spacer
-ctgaccagcgcgtccgggtccgtctcgccggtct	Protospacer
 *.*  * * *************.*****.**** 

37. spacer 6.17|780403|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.765

gagttctcgggggcgggccgcgatcagcccctcc	CRISPR spacer
ggacaggcgggcgcgggccgcgatcagctcctcc	Protospacer
*...   **** ****************.*****

38. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

39. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

40. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

41. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

42. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

43. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

44. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

45. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

46. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

47. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
cgggcggcgatcgccatcggcgccacggaccggc	Protospacer
*.*** **** ***************  .** * 

48. spacer 6.31|781337|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MK249160 (Blackfly microvirus SF02 isolate 073, complete genome) position: , mismatch: 8, identity: 0.765

caggccgcgaacgccatcggcgccacccgcctgg	CRISPR spacer
caggccgcgggcgccatcggcgccgctaaccttc	Protospacer
*********..*************.*. .***  

49. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.758

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
ccgcatcgatcccaaggactacgccgcctacac	Protospacer
* .**************** *** ****. *. 

50. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 8, identity: 0.758

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
ccgcatcgatcccaaggactacgccgcctacac	Protospacer
* .**************** *** ****. *. 

51. spacer 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 8, identity: 0.742

tcgtcccggcggccgggcgagcctgggaggc	CRISPR spacer
gtctcccggcggccaggcgagcccggcatgg	Protospacer
 . ***********.********.** * * 

52. spacer 20.1|5327357|31|NZ_CP042997|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 8, identity: 0.742

tcgtcccggcggccgggcgagcctgggaggc	CRISPR spacer
tcggcccggcggccgggcgcgccggtaccgt	Protospacer
*** *************** *** * .  *.

53. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 9, identity: 0.735

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
ccggcgccggcgccctggtccgcctcgtcgccca	Protospacer
 * *********.** ***********..* .*.

54. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
gtcctggacctgctcgccgtcttcgccaccgtct	Protospacer
* * ****** *.**************** ..  

55. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
cgtctggaccagttcgacgtcgtcgccaccgtcg	Protospacer
 *. ************ **** ******* .. *

56. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 9, identity: 0.735

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
gttatggaccagttagccgccttcgccactggtg	Protospacer
* ..********** ****.********* .  *

57. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
cgtctggaccagttcgacgtcgtcgccaccgtcg	Protospacer
 *. ************ **** ******* .. *

58. spacer 6.14|780200|36|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MH067975 (Arthrobacter sp. strain ANT_H58 plasmid pA58H2, complete sequence) position: , mismatch: 9, identity: 0.75

ggaggccatgactgtccccaggatgcc-ggtagatgc	CRISPR spacer
attggccatgactgtatccaggatgccgggttggcg-	Protospacer
.  ************ .********** *** *..* 

59. spacer 6.18|780469|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.743

tcctcgaggatggggcggaggccgttgatcgtcgc	CRISPR spacer
tccttgaggatggggcgtaggccgtagtgcaaaac	Protospacer
****.************ ******* *  *.  .*

60. spacer 6.19|780536|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

gcgagcctggagatgatctacggggtgggctact	CRISPR spacer
gcgatgctggagatgatctacgggctctacgagg	Protospacer
****  ****************** *  .* *  

61. spacer 6.27|781070|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_009956 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence) position: , mismatch: 9, identity: 0.735

gcggccagatcgcgaaggtgatcggccagggctt	CRISPR spacer
ccgtcccgatcgcgaaggtgatcggcatcaggtg	Protospacer
 ** ** *******************   .* * 

62. spacer 6.27|781070|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

gcggccagatcgcgaaggtgatcggccagggctt	CRISPR spacer
acgagcaaatcgcgaaggtgatcggcaagaccga	Protospacer
.**. **.****************** **. *  

63. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 9, identity: 0.727

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
cgacatcgatccgaagaacgacgaagaatggaa	Protospacer
************ ***.******* *  .  .*

64. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015271 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 4, complete sequence) position: , mismatch: 9, identity: 0.727

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
acacatagatcccaacgacgacgacggtgcggc	Protospacer
  **** ******** ********** . * * 

65. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015277 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 5, complete sequence) position: , mismatch: 9, identity: 0.727

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
acacatagatcccaacgacgacgacggtgcggc	Protospacer
  **** ******** ********** . * * 

66. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012888 (Mycobacterium chimaera strain AH16 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
acacatagatcccaacgacgacgacggtgcggc	Protospacer
  **** ******** ********** . * * 

67. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022225 (Mycobacterium chimaera strain SJ42 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
acacatagatcccaacgacgacgacggtgcggc	Protospacer
  **** ******** ********** . * * 

68. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 9, identity: 0.727

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
cgacatcgatccgaagaacgacgaagaatggaa	Protospacer
************ ***.******* *  .  .*

69. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020329 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p3-JPH1, complete sequence) position: , mismatch: 9, identity: 0.727

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
acacatagatcccaacgacgacgacggtgcggc	Protospacer
  **** ******** ********** . * * 

70. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045968 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_05, complete sequence) position: , mismatch: 9, identity: 0.727

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
acacatagatcccaacgacgacgacggtgcggc	Protospacer
  **** ******** ********** . * * 

71. spacer 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ctggccccgggctcgggcgccgtcacgctctcgg	CRISPR spacer
atccgcctggtctcgggcgccgtcacgctcgccc	Protospacer
 *   **.** ******************* *  

72. spacer 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ctggccccgggctcgggcgccgtcacgctctcgg	CRISPR spacer
atccgcctggtctcgggcgccgtcacgctcgccc	Protospacer
 *   **.** ******************* *  

73. spacer 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ctggccccgggctcgggcgccgtcacgctctcgg	CRISPR spacer
atccgcctggtctcgggcgccgtcacgctcgccc	Protospacer
 *   **.** ******************* *  

74. spacer 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735

ctggccccgggctcgggcgccgtcacgctctcgg	CRISPR spacer
atccgcctggtctcgggcgccgtcacgctcgccc	Protospacer
 *   **.** ******************* *  

75. spacer 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ctggccccgggctcgggcgccgtcacgctctcgg	CRISPR spacer
atccgcctggtctcgggcgccgtcacgctcgccc	Protospacer
 *   **.** ******************* *  

76. spacer 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735

ctggccccgggctcgggcgccgtcacgctctcgg	CRISPR spacer
atccgcctggtctcgggcgccgtcacgctcgccc	Protospacer
 *   **.** ******************* *  

77. spacer 6.40|781933|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ctggccccgggctcgggcgccgtcacgctctcgg	CRISPR spacer
atccgcctggtctcgggcgccgtcacgctcgccc	Protospacer
 *   **.** ******************* *  

78. spacer 6.41|781999|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_015685 (Oligotropha carboxidovorans OM5 plasmid pOC167, complete sequence) position: , mismatch: 9, identity: 0.743

gtcaccggggcggagatcaccgacctggtgctgac	CRISPR spacer
gaagcggcggcggtgatcaccgtcctggtgctgtt	Protospacer
*  .* * ***** ******** ********** .

79. spacer 6.41|781999|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_007960 (Nitrobacter hamburgensis X14 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.743

gtcaccggggcggagatcaccgacctggtgctgac	CRISPR spacer
gaagcggcggcggtgatcaccgtcctggtgctgct	Protospacer
*  .* * ***** ******** ********** .

80. spacer 6.46|782332|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ccggtcagggcgaacgagcccgccgaggcggtca	CRISPR spacer
gcggtcagggagaccgagcccgccgtgatcgtgc	Protospacer
 ********* ** *********** *.. **  

81. spacer 6.46|782332|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.735

ccggtcagggcgaacgagcccgccgaggcggtca	CRISPR spacer
gcggtcagggagaccgagcccgccgtgatcgtgc	Protospacer
 ********* ** *********** *.. **  

82. spacer 6.46|782332|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ccggtcagggcgaacgagcccgccgaggcggtca	CRISPR spacer
gcggtcagggagaccgagcccgccgtgatcgtgc	Protospacer
 ********* ** *********** *.. **  

83. spacer 6.46|782332|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ccggtcagggcgaacgagcccgccgaggcggtca	CRISPR spacer
gcggtcagggagaccgagcccgccgtgatcgtgc	Protospacer
 ********* ** *********** *.. **  

84. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

85. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

86. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

87. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

88. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

89. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

90. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

91. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

92. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

93. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

94. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

95. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

96. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

97. spacer 6.9|779869|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

gccgcgccggcgtccgggtccgcctcgctggtcg	CRISPR spacer
agcgcgccgccgtccggctccgcctccaggtgca	Protospacer
. ******* ******* ********   *  *.

98. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
gtatcggaccaggtcgccgccttcgccaccggtg	Protospacer
*   .******* ******.********* .  *

99. spacer 6.10|779935|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcgtggaccagttcgccgtcttcgccacgacgg	CRISPR spacer
gtatcggaccagttggccgccttcgccactggtg	Protospacer
*   .********* ****.********* .  *

100. spacer 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MT657336 (Microbacterium phage ClearAsMud, complete genome) position: , mismatch: 10, identity: 0.706

caaatccagtgggcccgcgacgcgatccgccagt	CRISPR spacer
ctcccgtactgggtccgcggcgcgatccgccagg	Protospacer
*   . .* ****.*****.************* 

101. spacer 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 10, identity: 0.706

caaatccagtgggcccgcgacgcgatccgccagt	CRISPR spacer
ctcccgtactgggtccgcggcgcgatccgccagg	Protospacer
*   . .* ****.*****.************* 

102. spacer 6.16|780335|36|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722

acggcctcgctcgccgacgtgttcgaggattgggac	CRISPR spacer
gaagccttgctcgccgacctgttcgaggatcttgcg	Protospacer
. .****.********** ***********.  *  

103. spacer 6.17|780403|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

gagttctcgggggcgggccgcgatcagcccctcc	CRISPR spacer
gcggaaataggggccggcggcgatcagcccctcg	Protospacer
* *    ..***** *** ************** 

104. spacer 6.17|780403|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

----gagttctcgggggcgggccgcgatcagcccctcc	CRISPR spacer
cacgggg----cgggggcgcgccgcgatcagcgccatg	Protospacer
    *.*    ******** ************ ** . 

105. spacer 6.34|781536|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.706

ggcgccggggccggtcttacgccaccaccgccct	CRISPR spacer
cggtccgcggccggtcttccgccaccaccagatc	Protospacer
 *  *** ********** **********.  ..

106. spacer 6.35|781602|33|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to KY940711 (Bradyrhizobium phage BDU-MI-1, complete genome) position: , mismatch: 10, identity: 0.697

cgacatcgatcccaaggacgacgacgcccccga	CRISPR spacer
ggacatcgaccccgaggacgacgacaagtttgc	Protospacer
 ********.***.***********.  ...* 

107. spacer 6.36|781667|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 10, identity: 0.714

tgagcgggaggtcctccggcaccacatcggcaacg	CRISPR spacer
cgagcggcaggtcctccggctccacacaccctccc	Protospacer
.****** ************ *****.   *  * 

108. spacer 6.50|782598|35|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.714

ccgcgcggcgatctccgaaggccgcaggccgcccc	CRISPR spacer
gaggctgacgatctccgaacggcgcaggccgccgg	Protospacer
  *  .*.*********** * ***********  

109. spacer 6.60|783263|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 10, identity: 0.706

gtctcgatcctcgcccgctccctcgccccggccg	CRISPR spacer
accctcgcgctcgcccgccccctcaccccggccg	Protospacer
..*.. .. *********.*****.*********

110. spacer 6.60|783263|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 10, identity: 0.706

gtctcgatcctcgcccgctccctcgccccggccg	CRISPR spacer
accctcgcgctcgcccgccccctcaccccggccg	Protospacer
..*.. .. *********.*****.*********

111. spacer 6.60|783263|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 10, identity: 0.706

gtctcgatcctcgcccgctccctcgccccggccg	CRISPR spacer
accctcgcgctcgcccgccccctcaccccggccg	Protospacer
..*.. .. *********.*****.*********

112. spacer 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MN175603 (Microbacterium phage Tyrumbra, complete genome) position: , mismatch: 11, identity: 0.676

caaatccagtgggcccgcgacgcgatccgccagt	CRISPR spacer
ttcccgtactgggtccgcggcgcgatccgccagg	Protospacer
.   . .* ****.*****.************* 

113. spacer 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MN585986 (Microbacterium phage Ariadne, complete genome) position: , mismatch: 11, identity: 0.676

caaatccagtgggcccgcgacgcgatccgccagt	CRISPR spacer
ttcccgtactgggtccgcggcgcgatccgccagg	Protospacer
.   . .* ****.*****.************* 

114. spacer 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MN586007 (Microbacterium phage Smarties, complete genome) position: , mismatch: 11, identity: 0.676

caaatccagtgggcccgcgacgcgatccgccagt	CRISPR spacer
ttcccgtactgggtccgcggcgcgatccgccagg	Protospacer
.   . .* ****.*****.************* 

115. spacer 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MH271312 (Microbacterium phage RobsFeet, complete genome) position: , mismatch: 11, identity: 0.676

caaatccagtgggcccgcgacgcgatccgccagt	CRISPR spacer
ttcccgtactgggtccgcggcgcgatccgccagg	Protospacer
.   . .* ****.*****.************* 

116. spacer 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to MK524510 (Microbacterium phage Fireman, complete genome) position: , mismatch: 11, identity: 0.676

caaatccagtgggcccgcgacgcgatccgccagt	CRISPR spacer
ttcccgtactgggtccgcggcgcgatccgccagg	Protospacer
.   . .* ****.*****.************* 

117. spacer 6.12|780067|34|NZ_CP042997|PILER-CR,CRISPRCasFinder,CRT matches to NC_047988 (Microbacterium phage Metamorphoo, complete genome) position: , mismatch: 11, identity: 0.676

caaatccagtgggcccgcgacgcgatccgccagt	CRISPR spacer
ttcccgtactgggtccgcggcgcgatccgccagg	Protospacer
.   . .* ****.*****.************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 236771 : 322060 59 Acidithiobacillus_phage(40.0%) transposase,protease NA
DBSCAN-SWA_2 1864280 : 2007889 104 Orpheovirus(12.5%) transposase,tRNA,protease NA
DBSCAN-SWA_3 2079710 : 2155131 47 Bodo_saltans_virus(20.0%) transposase,plate,protease NA
DBSCAN-SWA_4 6700066 : 6749939 43 Mycobacterium_phage(18.18%) transposase,plate,tail NA
DBSCAN-SWA_5 6923160 : 6997200 49 Paramecium_bursaria_Chlorella_virus(11.11%) transposase,protease NA
DBSCAN-SWA_6 7897517 : 7969692 55 Bacillus_phage(20.0%) transposase,protease NA
DBSCAN-SWA_7 9942905 : 10000416 44 Microcystis_virus(25.0%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage