Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041623 Escherichia coli O157:H7 strain ATCC 43888 chromosome, complete genome 6 crisprs cas3,WYL,c2c9_V-U4,DEDDh,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,PrimPol,RT,DinG 0 8 12 0
NZ_CP041624 Escherichia coli O157:H7 strain ATCC 43888 plasmid pO157_like, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP041625 Escherichia coli O157:H7 strain ATCC 43888 plasmid p35K_like, complete sequence 1 crisprs NA 0 1 0 0

Results visualization

1. NZ_CP041623
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041623_1 246518-246652 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041623_2 271419-271555 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041623_3 505475-505624 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041623_4 2182499-2182587 Unclear I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041623_5 2208279-2208491 TypeI-E I-E
3 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041623_6 2732335-2732440 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041623_2 2.1|271440|42|NZ_CP041623|PILER-CR 271440-271481 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141084-141125 0 1.0
NZ_CP041623_5 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT 2208309-2208339 31 MK047640 Phage NV18, complete genome 15646-15676 1 0.968
NZ_CP041623_5 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder 2208309-2208340 32 MK047640 Phage NV18, complete genome 15645-15676 1 0.969
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101196-101230 2 0.943
NZ_CP041623_5 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT 2208309-2208339 31 MF417881 Uncultured Caudovirales phage clone 7AX_3, partial genome 2718-2748 2 0.935
NZ_CP041623_5 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder 2208309-2208340 32 MF417881 Uncultured Caudovirales phage clone 7AX_3, partial genome 2718-2749 2 0.938
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165464-165498 3 0.914
NZ_CP041623_2 2.2|271503|36|NZ_CP041623|PILER-CR 271503-271538 36 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141031-141066 3 0.917
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14239-14273 5 0.857
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56080-56114 5 0.857
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 6804-6838 6 0.829
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208981-209015 6 0.829
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219475-219509 6 0.829
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210309-210343 6 0.829
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191264-191298 6 0.829
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30177-30211 6 0.829
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 170-204 6 0.829
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 88-122 6 0.829
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87137-87171 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 138033-138067 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 43-77 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3372-3406 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208887-208921 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 42-76 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3371-3405 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219381-219415 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 42-76 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3371-3405 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210215-210249 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 42-76 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3371-3405 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191170-191204 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27246-27280 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18350-18384 7 0.8
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15018-15052 7 0.8
NZ_CP041623_5 5.3|2208431|31|NZ_CP041623|CRT 2208431-2208461 31 NC_015512 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence 90200-90230 7 0.774
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61916-61950 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4114-4148 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229148-229182 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229249-229283 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229350-229384 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229451-229485 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 203852-203886 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204038-204072 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204131-204165 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4113-4147 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239642-239676 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239743-239777 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239844-239878 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239945-239979 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214346-214380 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214532-214566 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214625-214659 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4113-4147 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230554-230588 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230655-230689 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230756-230790 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230857-230891 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205180-205214 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205366-205400 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205459-205493 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4113-4147 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211524-211558 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211625-211659 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211726-211760 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211827-211861 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186135-186169 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186321-186355 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186414-186448 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 14272-14306 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6744-6778 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7392-7426 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83590-83624 8 0.771
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84216-84250 8 0.771
NZ_CP041623_5 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT 2208309-2208339 31 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 102901-102931 8 0.742
NZ_CP041623_5 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT 2208309-2208339 31 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 313484-313514 8 0.742
NZ_CP041623_5 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT 2208309-2208339 31 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 984473-984503 8 0.742
NZ_CP041623_5 5.6|2208431|32|NZ_CP041623|CRISPRCasFinder 2208431-2208462 32 NC_015512 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence 90200-90231 8 0.75
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 262-315 8 0.852
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12103-12156 8 0.852
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41406-41459 8 0.852
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386558-386592 9 0.743
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4013-4047 9 0.743
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4012-4046 9 0.743
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4012-4046 9 0.743
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4012-4046 9 0.743
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 13988-14022 9 0.743
NZ_CP041623_1 1.1|246568|35|NZ_CP041623|CRISPRCasFinder 246568-246602 35 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41415-41449 9 0.743
NZ_CP041623_5 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder 2208309-2208340 32 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 102900-102931 9 0.719
NZ_CP041623_5 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder 2208309-2208340 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 313483-313514 9 0.719
NZ_CP041623_5 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder 2208309-2208340 32 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 984472-984503 9 0.719
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229441-229494 10 0.815
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239935-239988 10 0.815
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7383-7436 10 0.815
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84207-84260 10 0.815
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87127-87180 10 0.815
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230847-230900 10 0.815
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211817-211870 10 0.815
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4105-4158 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3363-3416 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4104-4157 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3362-3415 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4104-4157 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3362-3415 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4104-4157 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3362-3415 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31242-31295 11 0.796
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 34-87 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4004-4057 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229239-229292 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229340-229393 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 33-86 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4003-4056 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239733-239786 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239834-239887 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 33-86 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4003-4056 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230645-230698 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230746-230799 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 33-86 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4003-4056 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211615-211668 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211716-211769 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15008-15061 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18340-18393 12 0.778
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30167-30220 13 0.759
NZ_CP041623_6 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder 2732361-2732414 54 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 160-213 14 0.741

1. spacer 2.1|271440|42|NZ_CP041623|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacacgcagataaatccaactttcaatattgttaagttcc	CRISPR spacer
gtcacacgcagataaatccaactttcaatattgttaagttcc	Protospacer
******************************************

2. spacer 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT matches to MK047640 (Phage NV18, complete genome) position: , mismatch: 1, identity: 0.968

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgacaaaaagtgtcaccaa	Protospacer
********************* *********

3. spacer 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder matches to MK047640 (Phage NV18, complete genome) position: , mismatch: 1, identity: 0.969

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgacaaaaagtgtcaccaaa	Protospacer
********************* **********

4. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.943

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ttcagcgcctgatgcgacgctggcgcgtcttatca	Protospacer
**********************.*********** 

5. spacer 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT matches to MF417881 (Uncultured Caudovirales phage clone 7AX_3, partial genome) position: , mismatch: 2, identity: 0.935

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaatcagtgacaaaaagtgtcaccaa	Protospacer
******** ************ *********

6. spacer 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder matches to MF417881 (Uncultured Caudovirales phage clone 7AX_3, partial genome) position: , mismatch: 2, identity: 0.938

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaatcagtgacaaaaagtgtcaccaaa	Protospacer
******** ************ **********

7. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.914

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgtaacgcctgatgcgacgctgacgcgtcttatct	Protospacer
* .*.******************************

8. spacer 2.2|271503|36|NZ_CP041623|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.917

acggcgtagcaaaaagaaattttcaatattgtttta	CRISPR spacer
atggcgtagaaaaaagaaattttcaatattgcttta	Protospacer
*.******* *********************.****

9. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 5, identity: 0.857

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accagcgcctgatgcgccgctgtcgcgtcttatca	Protospacer
 .************** ***** *********** 

10. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 5, identity: 0.857

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ctcaacgcctgatgcgacgctggcgcgtcttagcg	Protospacer
.***.*****************.********* * 

11. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gtttatgccagatgcgacgctgacgcgtcttatct	Protospacer
 *. ..*** *************************

12. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

13. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

14. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

15. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

16. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*.....**************************** 

17. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
attgaagcctgatgcgacgctgacgcgtcttatca	Protospacer
 *... **************************** 

18. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .*...**************************** 

19. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
cacgatgcctgatgcgacgctgccgcgtcttatca	Protospacer
. *...**************** *********** 

20. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgcgctgcctgatgcgacgctaatgcgtcttatca	Protospacer
* *. .***************.*.********** 

21. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

22. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

23. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

24. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

25. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

26. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

27. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

28. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

29. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

30. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

31. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

32. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

33. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accggtgccagatgcgacgcagacgcgtcttatca	Protospacer
 .*.*.*** ********** ************* 

34. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

35. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. .*.****************.*********** 

36. spacer 5.3|2208431|31|NZ_CP041623|CRT matches to NC_015512 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence) position: , mismatch: 7, identity: 0.774

gcccaggg---atttgttcaatccagcgtgccgc	CRISPR spacer
---caaagtccatttgttcaacccatcgtgccgc	Protospacer
   **..*   **********.*** ********

37. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgccagatgcgacgctggcgcgtcttatct	Protospacer
 . ...*** ************.************

38. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

39. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

40. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

41. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

42. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

43. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

44. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

45. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

46. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

47. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

48. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

49. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

50. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

51. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

52. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

53. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

54. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

55. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

56. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

57. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

58. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

59. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

60. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

61. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

62. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

63. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

64. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

65. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

66. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

67. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

68. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

69. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

70. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgaattacctgatgcgacgctggcgcatcttatca	Protospacer
*  * ..***************.***.******* 

71. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . ...*******.******************** 

72. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...****************.*********** 

73. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . ...*******.******************** 

74. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...****************.*********** 

75. spacer 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactg	Protospacer
************** ****.*** *.. * .

76. spacer 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactg	Protospacer
************** ****.*** *.. * .

77. spacer 5.1|2208309|31|NZ_CP041623|PILER-CR,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacggtgccaaaaactcttgactg	Protospacer
**********.*** ******** *.. * .

78. spacer 5.6|2208431|32|NZ_CP041623|CRISPRCasFinder matches to NC_015512 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence) position: , mismatch: 8, identity: 0.75

gcccaggg---atttgttcaatccagcgtgccgct	CRISPR spacer
---caaagtccatttgttcaacccatcgtgccgca	Protospacer
   **..*   **********.*** ******** 

79. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catccggcaatcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaaa	Protospacer
**. * *** .* .***************** **********************

80. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccg-catcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gctccgacgttcggtgcctgatgcgacgctggcgcgtcttatcaggcctacgag	Protospacer
 .* *** *.*.* **************************************.*.

81. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-aggcaccgtgctgatgtctgatgcgacgctggcgcgtcttatcagacctacaaa	Protospacer
 * **  *.* *** **.****************************.********

82. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgatgctaacgcgtcttatca	Protospacer
 .....***********.***.************ 

83. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

84. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

85. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

86. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

87. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
acggatgcccgatgcgacgctggcgcgtcttatcg	Protospacer
 . ...***.************.*********** 

88. spacer 1.1|246568|35|NZ_CP041623|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgtctgatgcgacgctggcgcgtcttatca	Protospacer
 .....*.**************.*********** 

89. spacer 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactgt	Protospacer
************** ****.*** *.. * . 

90. spacer 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactgc	Protospacer
************** ****.*** *.. * . 

91. spacer 5.4|2208309|32|NZ_CP041623|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacggtgccaaaaactcttgactgc	Protospacer
**********.*** ******** *.. * . 

92. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

93. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

94. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.815

cacgcc-gcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gcgctggtgccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
 .***. *...*  .****************************** *********

95. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.815

cacgcc-gcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gcgctggtgccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
 .***. *...*  .****************************** *********

96. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cattcggtgcacgatgcctgatgcgacgctgccgcgtcttatcaggcctacaaa	Protospacer
**. * *... * .***************** **********************

97. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

98. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

99. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

100. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

101. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

102. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

103. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

104. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

105. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

106. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

107. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 11, identity: 0.796

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catccggtaatcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacagc	Protospacer
**. * *.* .* .***************** ********************. 

108. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

109. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

110. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

111. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

112. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

113. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

114. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

115. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

116. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

117. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

118. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

119. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

120. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

121. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

122. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

123. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

124. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.778

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
caacaattaccaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
**     .*.*  ******************************* ******.*.

125. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

126. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 13, identity: 0.759

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgctctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaat	Protospacer
**. .    **. .*****************.************ ******** 

127. spacer 6.1|2732361|54|NZ_CP041623|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 14, identity: 0.741

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
tctccggcaattgaagcctgatgcgacgctgacgcgtcttatcaggcctacnag	Protospacer
. . * *** .. . ****************.******************* *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9848 : 63470 55 Escherichia_phage(25.0%) tail,plate,transposase NA
DBSCAN-SWA_2 2308291 : 2331816 30 Stx2-converting_phage(35.29%) holin,integrase,tail,transposase attL 2299937:2299951|attR 2332687:2332701
DBSCAN-SWA_3 2609432 : 2614819 6 Enterobacteria_phage(50.0%) integrase attL 2598381:2598397|attR 2617015:2617031
DBSCAN-SWA_4 2859118 : 2868564 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 3013138 : 3092778 80 Escherichia_phage(34.69%) portal,transposase,terminase,holin,protease,tail,integrase,head attL 3012645:3012660|attR 3069724:3069739
DBSCAN-SWA_6 3353231 : 3481589 164 Enterobacteria_phage(33.33%) portal,capsid,transposase,holin,protease,tRNA,tail,integrase,lysis,head,terminase attL 3343891:3343906|attR 3485565:3485580
DBSCAN-SWA_7 3573220 : 3671145 129 Escherichia_phage(30.28%) portal,capsid,transposase,holin,tail,integrase,head,terminase attL 3565946:3565959|attR 3582682:3582695
DBSCAN-SWA_8 3853113 : 3910822 76 Escherichia_phage(39.71%) portal,capsid,terminase,holin,tRNA,tail,integrase,head attL 3849571:3849586|attR 3909983:3909998
DBSCAN-SWA_9 3995768 : 4063379 75 Stx2-converting_phage(39.62%) capsid,transposase,terminase,protease,holin,tail,head NA
DBSCAN-SWA_10 4376947 : 4428066 59 Enterobacteria_phage(63.33%) tail,integrase,tRNA,transposase attL 4370171:4370186|attR 4428145:4428160
DBSCAN-SWA_11 4485645 : 4533932 66 Enterobacteria_phage(36.96%) portal,transposase,terminase,holin,protease,tail,integrase,head attL 4518284:4518299|attR 4539650:4539665
DBSCAN-SWA_12 4764869 : 4802976 52 Enterobacteria_phage(52.38%) portal,protease,holin,tail,lysis,integrase,terminase attL 4764454:4764468|attR 4803050:4803064
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP041624
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25318 : 37977 16 Macacine_betaherpesvirus(50.0%) transposase,integrase attL 14054:14068|attR 39750:39764
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP041625
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041625_1 17053-17161 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_KY446064 Escherichia coli strain GD81 plasmid pGD81-1, complete sequence 44851-44897 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP042629 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence 12655-12701 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP041625 Escherichia coli O157:H7 strain ATCC 43888 plasmid p35K_like, complete sequence 17084-17130 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP028594 Escherichia coli strain 150 plasmid pTA150-2, complete sequence 26791-26837 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP020924 Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence 30600-30646 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP038409 Escherichia coli O157:H7 strain 86-24 plasmid p86-24-2, complete sequence 30529-30575 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP028605 Escherichia coli strain 144 plasmid pTA144-2, complete sequence 29239-29285 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP038307 Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-3, complete sequence 27468-27514 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP038311 Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-3, complete sequence 29260-29306 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP038367 Escherichia coli O157:H7 strain F6667 plasmid pF6667-2, complete sequence 23563-23609 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP038303 Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-2, complete sequence 28381-28427 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP038337 Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-2, complete sequence 26050-26096 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_AP018807 Escherichia coli strain E2863 plasmid pE2863-5, complete sequence 30654-30700 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP007599 Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 plasmid pCFSAN000111_01, complete sequence 35471-35517 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 26621-26667 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP022051 Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence 11580-11626 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP038317 Escherichia coli O157:H7 strain NE92 plasmid pNE92-2, complete sequence 29606-29652 0 1.0
NZ_CP041625_1 1.1|17084|47|NZ_CP041625|CRISPRCasFinder 17084-17130 47 NZ_CP015845 Escherichia coli O157:H7 strain FRIK2455 plasmid p35K, complete sequence 3106-3152 0 1.0

1. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_KY446064 (Escherichia coli strain GD81 plasmid pGD81-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

2. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP042629 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

3. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP041625 (Escherichia coli O157:H7 strain ATCC 43888 plasmid p35K_like, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

4. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP028594 (Escherichia coli strain 150 plasmid pTA150-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

5. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP020924 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

6. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP038409 (Escherichia coli O157:H7 strain 86-24 plasmid p86-24-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

7. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP028605 (Escherichia coli strain 144 plasmid pTA144-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

8. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP038307 (Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

9. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP038311 (Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

10. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP038367 (Escherichia coli O157:H7 strain F6667 plasmid pF6667-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

11. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP038303 (Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

12. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP038337 (Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

13. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_AP018807 (Escherichia coli strain E2863 plasmid pE2863-5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

14. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP007599 (Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 plasmid pCFSAN000111_01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

15. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

16. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP022051 (Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

17. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP038317 (Escherichia coli O157:H7 strain NE92 plasmid pNE92-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

18. spacer 1.1|17084|47|NZ_CP041625|CRISPRCasFinder matches to NZ_CP015845 (Escherichia coli O157:H7 strain FRIK2455 plasmid p35K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	CRISPR spacer
ctgtccctctttgaccataaatttgtccccagataaaaacgccaaga	Protospacer
***********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage