Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042286 Staphylococcus argenteus strain B3-25B chromosome, complete genome 6 crisprs cas3,casR,DEDDh,DinG,csa3,WYL 2 0 8 0
NZ_CP042287 Staphylococcus argenteus strain B3-25B plasmid pSALNBL21, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP042286
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042286_1 63968-64062 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042286_2 200919-201000 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042286_3 849699-849944 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042286_4 883431-883516 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042286_5 2322912-2323010 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042286_6 2398141-2398258 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP042286_3 3.2|849805|34|NZ_CP042286|CRT 849805-849838 34 NZ_CP042286.1 849613-849646 0 1.0
NZ_CP042286_2 2.1|200946|28|NZ_CP042286|CRISPRCasFinder 200946-200973 28 NZ_CP042286.1 1565316-1565343 2 0.929

1. spacer 3.2|849805|34|NZ_CP042286|CRT matches to position: 849613-849646, mismatch: 0, identity: 1.0

tcaagagtgtagaggaacgcagttggaagctaag	CRISPR spacer
tcaagagtgtagaggaacgcagttggaagctaag	Protospacer
**********************************

2. spacer 2.1|200946|28|NZ_CP042286|CRISPRCasFinder matches to position: 1565316-1565343, mismatch: 2, identity: 0.929

ctgtagaaattgggatccaatttctctg	CRISPR spacer
ctgttgaaattgggttccaatttctctg	Protospacer
**** ********* *************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 947689 : 955498 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 967460 : 981845 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 1033217 : 1046721 20 Staphylococcus_phage(80.0%) integrase,coat,terminase attL 1027897:1027915|attR 1041297:1041315
DBSCAN-SWA_4 1176059 : 1230571 53 Streptococcus_phage(33.33%) bacteriocin,protease,holin,tRNA NA
DBSCAN-SWA_5 1250885 : 1259355 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1517790 : 1523963 8 Staphylococcus_phage(83.33%) NA NA
DBSCAN-SWA_7 1874606 : 1883651 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_8 2006898 : 2054456 45 Staphylococcus_phage(94.59%) transposase,protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage