Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024950 Helicobacter pylori strain B130A chromosome, complete genome 2 crisprs cas14j,cas3,c2c9_V-U4 0 2 0 0

Results visualization

1. NZ_CP024950
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024950_1 577924-578120 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024950_2 1493959-1494044 TypeV-U4 NA
1 spacers
c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024950_1 1.1|577950|28|NZ_CP024950|CRISPRCasFinder 577950-577977 28 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 1090166-1090193 5 0.821
NZ_CP024950_1 1.1|577950|28|NZ_CP024950|CRISPRCasFinder 577950-577977 28 KJ101592 Enterobacter phage PG7, complete genome 168930-168957 6 0.786
NZ_CP024950_1 1.1|577950|28|NZ_CP024950|CRISPRCasFinder 577950-577977 28 GU323318 Enterobacteria phage CC31, complete genome 161397-161424 6 0.786
NZ_CP024950_1 1.1|577950|28|NZ_CP024950|CRISPRCasFinder 577950-577977 28 LT614807 Cronobacter phage Pet-CM3-4 genome assembly, chromosome: I 167672-167699 6 0.786
NZ_CP024950_1 1.2|578004|31|NZ_CP024950|CRISPRCasFinder 578004-578034 31 MK448589 Streptococcus satellite phage Javan632, complete genome 4591-4621 6 0.806
NZ_CP024950_1 1.2|578004|31|NZ_CP024950|CRISPRCasFinder 578004-578034 31 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 752262-752292 8 0.742

1. spacer 1.1|577950|28|NZ_CP024950|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 5, identity: 0.821

gtgtcgttattaaagctagtattgtcat	CRISPR spacer
gtgtcgttactaaagctaatattcttac	Protospacer
*********.********.**** *.*.

2. spacer 1.1|577950|28|NZ_CP024950|CRISPRCasFinder matches to KJ101592 (Enterobacter phage PG7, complete genome) position: , mismatch: 6, identity: 0.786

gtgtcgttattaaagctagtattgtcat	CRISPR spacer
aagaagttattgaaggtagtattgtcat	Protospacer
. *  ******.*** ************

3. spacer 1.1|577950|28|NZ_CP024950|CRISPRCasFinder matches to GU323318 (Enterobacteria phage CC31, complete genome) position: , mismatch: 6, identity: 0.786

gtgtcgttattaaagctagtattgtcat	CRISPR spacer
aagaagttattgaaggtagtattgtcat	Protospacer
. *  ******.*** ************

4. spacer 1.1|577950|28|NZ_CP024950|CRISPRCasFinder matches to LT614807 (Cronobacter phage Pet-CM3-4 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.786

gtgtcgttattaaagctagtattgtcat	CRISPR spacer
aagaagttattgaaggtagtattgtcat	Protospacer
. *  ******.*** ************

5. spacer 1.2|578004|31|NZ_CP024950|CRISPRCasFinder matches to MK448589 (Streptococcus satellite phage Javan632, complete genome) position: , mismatch: 6, identity: 0.806

ttgctgttttcaaaagcagattgggtgctat-	CRISPR spacer
ttgctgttttcaaaaggcgatt-ggtacggtt	Protospacer
****************  **** ***.* .* 

6. spacer 1.2|578004|31|NZ_CP024950|CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 8, identity: 0.742

ttgctgttttcaaaagcagattgggtgctat	CRISPR spacer
ttgctgttttcaaaaggagattgccttgatc	Protospacer
**************** ******  *    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage