Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012297 Corynebacterium glutamicum strain B414, complete genome 4 crisprs DEDDh,csa3,cas3,WYL,PrimPol,RT,DinG 0 1 0 0

Results visualization

1. NZ_CP012297
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012297_1 256878-256990 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012297_2 848052-848158 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012297_3 1457264-1457360 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012297_4 1823532-1823632 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012297_1 1.1|256918|33|NZ_CP012297|CRISPRCasFinder 256918-256950 33 NC_005909 Pseudomonas alcaligenes plasmid pRA2, complete sequence 22369-22401 9 0.727

1. spacer 1.1|256918|33|NZ_CP012297|CRISPRCasFinder matches to NC_005909 (Pseudomonas alcaligenes plasmid pRA2, complete sequence) position: , mismatch: 9, identity: 0.727

gacaccagcgaacgaaagtgggcgggcttggtg	CRISPR spacer
ttgatccgcgaacgaacgcgggcgggcttggaa	Protospacer
   *.* ********* *.************ .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage