Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031275 Staphylococcus xylosus strain 2 chromosome, complete genome 5 crisprs csa3,WYL,DEDDh,cas3,DinG 0 1 8 0
NZ_CP031276 Staphylococcus xylosus strain 2 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP031275
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031275_1 200132-200232 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031275_2 1125700-1125778 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031275_3 1159326-1159407 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031275_4 1937969-1938047 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031275_5 1944924-1945012 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031275_3 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder 1159352-1159381 30 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 182767-182796 8 0.733
NZ_CP031275_3 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder 1159352-1159381 30 NZ_CP013276 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence 116163-116192 8 0.733
NZ_CP031275_3 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder 1159352-1159381 30 NZ_CP039722 Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence 253501-253530 8 0.733
NZ_CP031275_3 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder 1159352-1159381 30 NZ_CP009349 Bacillus thuringiensis HD1002 plasmid 1, complete sequence 192163-192192 8 0.733
NZ_CP031275_3 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder 1159352-1159381 30 NZ_CP045023 Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence 116164-116193 8 0.733
NZ_CP031275_3 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder 1159352-1159381 30 NC_018689 Bacillus thuringiensis MC28 plasmid pMC429, complete sequence 23867-23896 8 0.733
NZ_CP031275_3 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder 1159352-1159381 30 NZ_CP045608 Bacillus cereus strain SB1 plasmid p2, complete sequence 127271-127300 8 0.733
NZ_CP031275_3 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder 1159352-1159381 30 MK448506 Streptococcus satellite phage Javan462, complete genome 11918-11947 9 0.7

1. spacer 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 8, identity: 0.733

aaatcattgcaattttctatataccctgtt	CRISPR spacer
ttagcattacaattttttatatacccttaa	Protospacer
  * ****.*******.**********   

2. spacer 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder matches to NZ_CP013276 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence) position: , mismatch: 8, identity: 0.733

aaatcattgcaattttctatataccctgtt	CRISPR spacer
ttagcattacaattttttatatacccttaa	Protospacer
  * ****.*******.**********   

3. spacer 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder matches to NZ_CP039722 (Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

aaatcattgcaattttctatataccctgtt	CRISPR spacer
ttagcattacaattttttatatacccttaa	Protospacer
  * ****.*******.**********   

4. spacer 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder matches to NZ_CP009349 (Bacillus thuringiensis HD1002 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733

aaatcattgcaattttctatataccctgtt	CRISPR spacer
ttagcattacaattttttatatacccttaa	Protospacer
  * ****.*******.**********   

5. spacer 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder matches to NZ_CP045023 (Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

aaatcattgcaattttctatataccctgtt	CRISPR spacer
ttagcattacaattttttatatacccttaa	Protospacer
  * ****.*******.**********   

6. spacer 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder matches to NC_018689 (Bacillus thuringiensis MC28 plasmid pMC429, complete sequence) position: , mismatch: 8, identity: 0.733

aaatcattgcaattttctatataccctgtt	CRISPR spacer
ttagcattacaattttttatatacccttaa	Protospacer
  * ****.*******.**********   

7. spacer 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder matches to NZ_CP045608 (Bacillus cereus strain SB1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733

aaatcattgcaattttctatataccctgtt	CRISPR spacer
ttagcattacaattttttatatacccttaa	Protospacer
  * ****.*******.**********   

8. spacer 3.1|1159352|30|NZ_CP031275|CRISPRCasFinder matches to MK448506 (Streptococcus satellite phage Javan462, complete genome) position: , mismatch: 9, identity: 0.7

aaatcattgcaattttctatataccctgtt	CRISPR spacer
caatcattgcaattttttatataaataaag	Protospacer
 ***************.******  . .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1134610 : 1168720 35 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_2 1291490 : 1300689 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 1430004 : 1442366 14 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_4 1889233 : 1897709 9 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1932455 : 1939559 9 Staphylococcus_phage(66.67%) integrase attL 1929907:1929930|attR 1939725:1939748
DBSCAN-SWA_6 2099685 : 2115880 20 Staphylococcus_phage(30.0%) integrase,coat attL 2103595:2103610|attR 2119995:2120010
DBSCAN-SWA_7 2164721 : 2180682 13 uncultured_Caudovirales_phage(41.67%) NA NA
DBSCAN-SWA_8 2193952 : 2201342 9 Pandoravirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage