Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP036299 Planctopirus ephydatiae strain spb1 chromosome, complete genome 3 crisprs cas3,WYL,csa3,DinG,Cas9_archaeal,cas4,RT 1 2 1 0

Results visualization

1. NZ_CP036299
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036299_1 2103013-2103227 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036299_2 2281065-2281135 orTypeII NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036299_3 4233030-4233112 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP036299_1 1.3|2103132|25|NZ_CP036299|CRISPRCasFinder 2103132-2103156 25 NZ_CP036299.1 2103228-2103252 2 0.92

1. spacer 1.3|2103132|25|NZ_CP036299|CRISPRCasFinder matches to position: 2103228-2103252, mismatch: 2, identity: 0.92

gacctgcacaatcaagaagccggtc	CRISPR spacer
gacctgcacagtcaagaagcctgtc	Protospacer
**********.********** ***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP036299_1 1.2|2103084|25|NZ_CP036299|CRISPRCasFinder 2103084-2103108 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1734391-1734415 4 0.84
NZ_CP036299_1 1.2|2103084|25|NZ_CP036299|CRISPRCasFinder 2103084-2103108 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1892919-1892943 4 0.84
NZ_CP036299_1 1.4|2103180|25|NZ_CP036299|CRISPRCasFinder 2103180-2103204 25 NC_010811 Ralstonia phage RSL1, complete genome 144567-144591 5 0.8
NZ_CP036299_1 1.4|2103180|25|NZ_CP036299|CRISPRCasFinder 2103180-2103204 25 AB366653 Ralstonia phage RSL1 DNA, complete genome 144567-144591 5 0.8
NZ_CP036299_1 1.2|2103084|25|NZ_CP036299|CRISPRCasFinder 2103084-2103108 25 NC_008739 Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence 71803-71827 6 0.76

1. spacer 1.2|2103084|25|NZ_CP036299|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.84

gacctgcacgatcaagaagccggtt	CRISPR spacer
gacctgcgcgatcatgaagccggag	Protospacer
*******.****** ********  

2. spacer 1.2|2103084|25|NZ_CP036299|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 4, identity: 0.84

gacctgcacgatcaagaagccggtt	CRISPR spacer
gacctgcgcgatcatgaagccggag	Protospacer
*******.****** ********  

3. spacer 1.4|2103180|25|NZ_CP036299|CRISPRCasFinder matches to NC_010811 (Ralstonia phage RSL1, complete genome) position: , mismatch: 5, identity: 0.8

ctgctacaccaagtgccgtcctgtg	CRISPR spacer
tcgctacaccaagcgccgtcctgac	Protospacer
..***********.*********  

4. spacer 1.4|2103180|25|NZ_CP036299|CRISPRCasFinder matches to AB366653 (Ralstonia phage RSL1 DNA, complete genome) position: , mismatch: 5, identity: 0.8

ctgctacaccaagtgccgtcctgtg	CRISPR spacer
tcgctacaccaagcgccgtcctgac	Protospacer
..***********.*********  

5. spacer 1.2|2103084|25|NZ_CP036299|CRISPRCasFinder matches to NC_008739 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence) position: , mismatch: 6, identity: 0.76

gacctgcacgatcaagaagccggtt	CRISPR spacer
atcctgcacgatcaagaagcccacg	Protospacer
. ******************* .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4792899 : 4837753 37 Paenibacillus_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage