Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP036425 Planctomycetes bacterium KS4 chromosome, complete genome 2 crisprs csa3,WYL,cas3,DEDDh,DinG 1 0 1 0

Results visualization

1. NZ_CP036425
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036425_1 723770-723879 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036425_2 4073613-4073741 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP036425_1 1.1|723808|34|NZ_CP036425|CRISPRCasFinder 723808-723841 34 NZ_CP036425.1 723880-723913 2 0.941

1. spacer 1.1|723808|34|NZ_CP036425|CRISPRCasFinder matches to position: 723880-723913, mismatch: 2, identity: 0.941

tcactaaagcgtgtcgttggtaggtttaacatcc	CRISPR spacer
tcactaaagcatatcgttggtaggtttaacatcc	Protospacer
**********.*.*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1261014 : 1271095 8 Paenibacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage