Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041638 Thalassotalea sp. PS06 chromosome, complete genome 6 crisprs cas3,csa3,DinG,DEDDh 0 1 3 0

Results visualization

1. NZ_CP041638
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041638_1 785707-785844 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041638_2 1104580-1104705 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041638_3 1437009-1437153 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041638_4 1439107-1439242 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041638_5 2825703-2825818 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041638_6 2918036-2918147 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041638_4 4.1|1439135|26|NZ_CP041638|CRISPRCasFinder 1439135-1439160 26 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 445827-445852 5 0.808

1. spacer 4.1|1439135|26|NZ_CP041638|CRISPRCasFinder matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.808

tcatttcttccatccctggaatgatt	CRISPR spacer
tcatttcttccatctctggattgcga	Protospacer
**************.***** **   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1111219 : 1120916 11 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_2 2104949 : 2167766 49 Vibrio_phage(20.0%) integrase,tRNA,protease,transposase attL 2140854:2140876|attR 2161736:2161758
DBSCAN-SWA_3 2596150 : 2603328 8 Bacillus_thuringiensis_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage