Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041620 Shigella flexneri strain C32 chromosome, complete genome 5 crisprs DinG,DEDDh,cas3,cas14j,RT,WYL,csa3 0 4 363 0
NZ_CP041619 Shigella flexneri strain C32 plasmid pC32_1, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP041621 Shigella flexneri strain C32 plasmid pC32_2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP041620
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041620_1 332115-332238 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041620_2 1161225-1161375 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041620_3 2048766-2048898 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041620_4 2268727-2268876 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041620_5 4636531-4636648 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041620_3 3.1|2048783|42|NZ_CP041620|PILER-CR 2048783-2048824 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP041620_3 3.2|2048842|40|NZ_CP041620|PILER-CR 2048842-2048881 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
NZ_CP041620_1 1.1|332158|38|NZ_CP041620|CRISPRCasFinder 332158-332195 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP041620_2 2.1|1161253|32|NZ_CP041620|CRISPRCasFinder 1161253-1161284 32 NC_015163 Deinococcus proteolyticus MRP plasmid pDEIPR04, complete sequence 83332-83363 8 0.75
NZ_CP041620_3 3.2|2048842|40|NZ_CP041620|PILER-CR 2048842-2048881 40 NZ_CP034685 Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence 143235-143274 11 0.725

1. spacer 3.1|2048783|42|NZ_CP041620|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

2. spacer 3.2|2048842|40|NZ_CP041620|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagaaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********************************.*******

3. spacer 1.1|332158|38|NZ_CP041620|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 2.1|1161253|32|NZ_CP041620|CRISPRCasFinder matches to NC_015163 (Deinococcus proteolyticus MRP plasmid pDEIPR04, complete sequence) position: , mismatch: 8, identity: 0.75

ttgtcattattggcagacaggatccgcggcaa	CRISPR spacer
ttgtcaaaattggcagacaggatgccgtccag	Protospacer
******  *************** *    **.

5. spacer 3.2|2048842|40|NZ_CP041620|PILER-CR matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 11, identity: 0.725

catggcgtagaaaaaagaaattttcaatattgttttatgg-	CRISPR spacer
aacacaatagaaaaaagaaattttcaaccttg-tttatact	Protospacer
 *..  .********************. *** *****.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 15654 10 Bacillus_phage(50.0%) integrase attL 7473:7484|attR 17887:17898
DBSCAN-SWA_2 21836 : 22706 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_3 43025 : 44246 1 Ralstonia_phage(100.0%) integrase attL 42457:42470|attR 45481:45494
DBSCAN-SWA_4 48296 : 60665 12 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_5 76992 : 79257 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_6 91058 : 91811 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_7 103804 : 105319 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_8 115406 : 119675 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_9 124202 : 125936 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_10 132551 : 134602 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_11 138495 : 145556 9 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_12 149554 : 151030 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_13 159086 : 163555 7 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_14 171052 : 173101 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_15 178433 : 178643 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_16 184283 : 185840 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_17 189702 : 197808 8 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_18 206775 : 212063 4 Bacillus_phage(66.67%) transposase NA
DBSCAN-SWA_19 215381 : 216236 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_20 225049 : 229135 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_21 234061 : 238075 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_22 244384 : 245038 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_23 251801 : 253022 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_24 260498 : 261326 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_25 276280 : 295818 18 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_26 314291 : 319375 5 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_27 327665 : 329932 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_28 335438 : 344230 9 Orpheovirus(20.0%) NA NA
DBSCAN-SWA_29 349626 : 350148 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_30 357067 : 414216 58 uncultured_Caudovirales_phage(66.67%) tRNA,protease,head,portal,capsid,tail,integrase,terminase attL 375744:375760|attR 402424:402440
DBSCAN-SWA_31 424167 : 439605 15 Escherichia_phage(44.44%) NA NA
DBSCAN-SWA_32 443991 : 445626 2 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_33 452985 : 455115 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_34 461858 : 463277 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_35 487795 : 490195 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_36 493602 : 495361 3 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_37 506785 : 508330 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_38 514816 : 517222 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_39 522389 : 524354 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_40 528979 : 531082 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_41 536578 : 537592 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_42 541221 : 543183 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_43 556356 : 557305 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_44 561245 : 565148 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_45 582775 : 583765 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_46 588724 : 598145 6 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_47 602683 : 603199 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_48 620424 : 621507 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_49 640849 : 642867 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_50 651806 : 653741 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_51 661554 : 662145 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_52 667055 : 737396 87 Escherichia_phage(39.06%) protease,lysis,holin,head,tail,capsid,integrase,terminase attL 684429:684454|attR 737535:737560
DBSCAN-SWA_53 745328 : 747343 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_54 756909 : 768239 11 Citrobacter_phage(20.0%) transposase NA
DBSCAN-SWA_55 779358 : 785627 8 Spodoptera_litura_granulovirus(33.33%) NA NA
DBSCAN-SWA_56 788763 : 789711 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_57 803960 : 804719 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_58 820747 : 822435 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_59 835468 : 927506 98 Enterobacteria_phage(45.83%) tRNA,lysis,holin,head,tail,capsid,portal,transposase,integrase,terminase attL 854997:855012|attR 930458:930473
DBSCAN-SWA_60 930951 : 934673 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_61 941959 : 942217 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_62 954541 : 956184 2 Streptococcus_virus(50.0%) NA NA
DBSCAN-SWA_63 959456 : 960638 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_64 972994 : 973936 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_65 989815 : 990061 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_66 994722 : 995643 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_67 1009619 : 1010453 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_68 1022029 : 1022818 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_69 1037415 : 1039515 3 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_70 1042545 : 1043466 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_71 1048570 : 1055063 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_72 1066057 : 1066717 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_73 1070950 : 1073005 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 1085605 : 1087513 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_75 1096268 : 1107217 8 Bacillus_virus(20.0%) tRNA NA
DBSCAN-SWA_76 1121922 : 1126462 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_77 1131549 : 1132638 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_78 1136736 : 1139951 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_79 1143036 : 1166778 15 uncultured_Mediterranean_phage(18.18%) tRNA,protease NA
DBSCAN-SWA_80 1175900 : 1177619 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_81 1181206 : 1183944 4 Roseobacter_phage(50.0%) NA NA
DBSCAN-SWA_82 1187069 : 1196218 11 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_83 1204782 : 1205985 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_84 1217318 : 1219190 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_85 1222405 : 1229289 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_86 1234285 : 1239511 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_87 1246074 : 1257737 10 Synechococcus_phage(20.0%) NA NA
DBSCAN-SWA_88 1268333 : 1269242 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_89 1275568 : 1278099 2 Klosneuvirus(50.0%) transposase NA
DBSCAN-SWA_90 1288411 : 1294986 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_91 1299349 : 1302869 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_92 1330352 : 1331144 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_93 1334522 : 1342423 7 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_94 1345676 : 1346354 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_95 1353009 : 1353774 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_96 1357916 : 1360562 2 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_97 1365055 : 1365814 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_98 1368868 : 1370815 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_99 1375440 : 1377105 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_100 1381243 : 1382284 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_101 1390228 : 1395351 4 Planktothrix_phage(50.0%) tRNA NA
DBSCAN-SWA_102 1402361 : 1404801 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_103 1409016 : 1409663 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_104 1423751 : 1425866 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_105 1428971 : 1430794 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_106 1445085 : 1451128 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_107 1462516 : 1464061 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_108 1473552 : 1476696 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_109 1479841 : 1480525 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_110 1490749 : 1495225 5 Enterobacteria_phage(33.33%) tRNA,tail NA
DBSCAN-SWA_111 1507259 : 1508405 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1514595 : 1516377 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_113 1522812 : 1523499 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_114 1526635 : 1527313 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_115 1534810 : 1538052 3 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_116 1546288 : 1554733 8 Acanthamoeba_polyphaga_moumouvirus(25.0%) NA NA
DBSCAN-SWA_117 1561741 : 1564891 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_118 1573728 : 1577275 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_119 1580598 : 1581294 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_120 1584434 : 1589481 4 Bacillus_phage(25.0%) protease NA
DBSCAN-SWA_121 1614941 : 1623784 10 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_122 1630734 : 1640832 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_123 1645118 : 1646234 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_124 1653649 : 1654807 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_125 1661715 : 1662483 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_126 1667775 : 1675057 5 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_127 1680015 : 1681902 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_128 1689549 : 1690599 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_129 1701027 : 1710626 6 Shigella_phage(25.0%) transposase,holin,integrase attL 1689387:1689401|attR 1711339:1711353
DBSCAN-SWA_130 1720537 : 1723842 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_131 1729887 : 1730739 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_132 1749027 : 1758638 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_133 1763315 : 1764455 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_134 1788972 : 1793497 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_135 1807672 : 1810995 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_136 1820575 : 1822558 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_137 1826437 : 1828396 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_138 1839086 : 1841849 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_139 1851111 : 1858963 9 Bradyrhizobium_phage(25.0%) NA NA
DBSCAN-SWA_140 1865484 : 1866516 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_141 1879474 : 1883590 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_142 1892418 : 1893177 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_143 1905474 : 1906899 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_144 1910828 : 1911173 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_145 1917084 : 1917882 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_146 1923032 : 1929838 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_147 1939734 : 1940619 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_148 1943881 : 1950349 5 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_149 1958169 : 1959594 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_150 1972135 : 1972687 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_151 1976933 : 1977977 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_152 2003947 : 2005672 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_153 2017150 : 2017849 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_154 2026124 : 2031547 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_155 2039292 : 2041253 4 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_156 2049147 : 2054796 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_157 2060296 : 2061445 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_158 2065871 : 2080395 12 Tupanvirus(16.67%) tRNA NA
DBSCAN-SWA_159 2083530 : 2084484 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_160 2096251 : 2098365 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_161 2101642 : 2107452 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_162 2114172 : 2115495 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_163 2121182 : 2124058 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_164 2131886 : 2133166 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_165 2143791 : 2145456 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_166 2150697 : 2154666 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_167 2159542 : 2160463 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_168 2166409 : 2167066 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_169 2173533 : 2174994 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_170 2185260 : 2186937 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_171 2190299 : 2191280 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_172 2214217 : 2216627 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_173 2236796 : 2243576 5 uncultured_Caudovirales_phage(25.0%) transposase,holin NA
DBSCAN-SWA_174 2253785 : 2257937 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_175 2263066 : 2272342 6 Klebsiella_phage(33.33%) tRNA NA
DBSCAN-SWA_176 2280806 : 2286903 6 Paramecium_bursaria_Chlorella_virus(66.67%) NA NA
DBSCAN-SWA_177 2290541 : 2293302 2 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_178 2297490 : 2303978 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_179 2338888 : 2340052 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_180 2349106 : 2362131 11 Lactococcus_phage(20.0%) tRNA,protease NA
DBSCAN-SWA_181 2366046 : 2366592 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_182 2374312 : 2375290 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_183 2380210 : 2380744 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_184 2384948 : 2386932 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_185 2395266 : 2396532 1 Enterobacteria_phage(100.0%) integrase attL 2393603:2393616|attR 2405071:2405084
DBSCAN-SWA_186 2427708 : 2428284 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_187 2435109 : 2438691 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_188 2450189 : 2452360 4 Yersinia_phage(33.33%) NA NA
DBSCAN-SWA_189 2460987 : 2464199 2 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_190 2483763 : 2485266 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_191 2490105 : 2490894 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_192 2496504 : 2498054 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_193 2504176 : 2510545 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_194 2515790 : 2517938 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_195 2521855 : 2523383 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_196 2533319 : 2535278 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_197 2541575 : 2542925 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_198 2546741 : 2550355 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_199 2560472 : 2561891 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_200 2567461 : 2570009 2 Yellowstone_lake_mimivirus(50.0%) NA NA
DBSCAN-SWA_201 2575047 : 2575656 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_202 2583189 : 2584305 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_203 2608644 : 2612328 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_204 2632976 : 2634740 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_205 2643035 : 2651364 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_206 2655359 : 2658412 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_207 2666751 : 2672534 5 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_208 2677974 : 2679189 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_209 2691333 : 2698580 5 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_210 2705393 : 2706947 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_211 2722657 : 2803746 88 Escherichia_phage(42.55%) tRNA,plate,protease,lysis,holin,head,tail,capsid,portal,integrase,terminase attL 2738590:2738636|attR 2772392:2772438
DBSCAN-SWA_212 2823159 : 2825630 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_213 2829751 : 2832538 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_214 2846227 : 2846842 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_215 2855712 : 2858999 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_216 2880993 : 2882502 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_217 2892962 : 2894792 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_218 2902151 : 2910758 8 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_219 2918887 : 2920543 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_220 2928549 : 2934693 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_221 2938735 : 2944149 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_222 2951745 : 2953392 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_223 2966783 : 2970174 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_224 2975803 : 2976796 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_225 2988750 : 2996265 6 Chrysochromulina_ericina_virus(25.0%) NA NA
DBSCAN-SWA_226 3006636 : 3007974 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_227 3018172 : 3025541 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_228 3030246 : 3031395 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_229 3035822 : 3047700 12 Cyanophage(16.67%) NA NA
DBSCAN-SWA_230 3055004 : 3056339 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_231 3061779 : 3073955 12 Enterobacteria_phage(88.89%) integrase attL 3062868:3062890|attR 3074116:3074138
DBSCAN-SWA_232 3087326 : 3088718 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_233 3093019 : 3099770 6 Bordetella_phage(25.0%) NA NA
DBSCAN-SWA_234 3103144 : 3107707 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_235 3115145 : 3117239 2 Archaeal_BJ1_virus(50.0%) NA NA
DBSCAN-SWA_236 3120647 : 3130153 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_237 3156754 : 3167296 5 Enterobacterial_phage(33.33%) NA NA
DBSCAN-SWA_238 3186870 : 3188412 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_239 3193729 : 3194725 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_240 3198946 : 3199159 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_241 3202813 : 3205147 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_242 3220933 : 3222918 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_243 3268856 : 3270326 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_244 3280996 : 3286405 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_245 3296091 : 3301173 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_246 3309066 : 3313365 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_247 3316371 : 3319190 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_248 3324913 : 3326396 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_249 3329937 : 3331748 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_250 3342623 : 3344720 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_251 3355049 : 3357497 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_252 3372901 : 3374128 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_253 3378518 : 3380912 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_254 3387141 : 3388035 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_255 3394616 : 3398384 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_256 3415289 : 3416126 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_257 3435037 : 3444589 9 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_258 3450159 : 3458726 8 uncultured_Caudovirales_phage(40.0%) NA NA
DBSCAN-SWA_259 3467556 : 3469509 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_260 3490733 : 3492205 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_261 3502542 : 3506696 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_262 3513200 : 3514085 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_263 3519422 : 3523935 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_264 3533222 : 3534266 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_265 3551917 : 3553285 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_266 3557251 : 3561262 4 Pseudomonas_phage(50.0%) protease NA
DBSCAN-SWA_267 3569965 : 3584760 17 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_268 3588828 : 3590311 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_269 3596939 : 3599812 2 Micromonas_pusilla_virus(50.0%) protease NA
DBSCAN-SWA_270 3603892 : 3610530 3 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_271 3616011 : 3617901 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_272 3623603 : 3631397 10 Diadromus_pulchellus_ascovirus(25.0%) NA NA
DBSCAN-SWA_273 3655183 : 3656329 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_274 3664534 : 3666829 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_275 3687407 : 3688373 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_276 3701227 : 3717423 12 Herpes_simplex_virus(16.67%) tRNA NA
DBSCAN-SWA_277 3723823 : 3725062 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_278 3730199 : 3731633 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_279 3741149 : 3752112 12 Staphylococcus_phage(20.0%) NA NA
DBSCAN-SWA_280 3755939 : 3756332 1 Stx_converting_phage(100.0%) NA NA
DBSCAN-SWA_281 3759642 : 3761901 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_282 3769359 : 3776678 6 Ostreococcus_tauri_virus(33.33%) NA NA
DBSCAN-SWA_283 3782521 : 3783406 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_284 3805581 : 3806754 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_285 3821109 : 3886537 48 Acinetobacter_phage(28.57%) lysis,protease,transposase NA
DBSCAN-SWA_286 3894672 : 3895938 1 Enterobacteria_phage(100.0%) integrase attL 3893924:3893938|attR 3902516:3902530
DBSCAN-SWA_287 3918623 : 3919778 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_288 3927819 : 3928728 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_289 3933779 : 3934457 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_290 3947951 : 3949184 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_291 3957320 : 3961793 2 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_292 3965598 : 3980990 14 Brevibacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_293 4005269 : 4006025 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_294 4010310 : 4012805 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_295 4022436 : 4029208 6 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_296 4034685 : 4051300 10 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_297 4067375 : 4069892 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_298 4074252 : 4076886 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_299 4085716 : 4088222 3 Pandoravirus(50.0%) tRNA NA
DBSCAN-SWA_300 4099797 : 4100553 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_301 4105411 : 4106260 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_302 4113792 : 4117907 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_303 4121940 : 4124964 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_304 4128761 : 4131960 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_305 4139260 : 4140046 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_306 4154695 : 4156728 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_307 4159839 : 4163555 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_308 4167928 : 4175068 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_309 4194588 : 4195599 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_310 4203074 : 4204040 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_311 4209506 : 4214893 5 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_312 4219504 : 4219963 1 Saccharomonospora_phage(100.0%) transposase NA
DBSCAN-SWA_313 4228285 : 4233583 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_314 4238800 : 4242851 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_315 4247787 : 4259234 13 Enterobacteria_phage(77.78%) integrase attL 4247132:4247144|attR 4258108:4258120
DBSCAN-SWA_316 4272867 : 4273938 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_317 4279843 : 4282417 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_318 4297498 : 4303581 7 Achromobacter_phage(25.0%) tRNA NA
DBSCAN-SWA_319 4309352 : 4313094 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_320 4316553 : 4316814 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_321 4320933 : 4332242 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_322 4338000 : 4339512 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_323 4349630 : 4355968 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_324 4365854 : 4366286 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_325 4386766 : 4393255 7 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_326 4399502 : 4403503 4 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_327 4410982 : 4411696 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_328 4428937 : 4429888 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_329 4448802 : 4470530 22 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_330 4496306 : 4497041 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_331 4500857 : 4501778 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_332 4505467 : 4513044 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_333 4519684 : 4521118 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_334 4524155 : 4525088 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_335 4541545 : 4542631 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_336 4551167 : 4552304 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_337 4559053 : 4560571 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_338 4564782 : 4566642 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_339 4577201 : 4580429 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_340 4613744 : 4618748 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_341 4622355 : 4626914 5 Oenococcus_phage(50.0%) transposase NA
DBSCAN-SWA_342 4632806 : 4638953 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_343 4644397 : 4647025 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_344 4661948 : 4666791 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_345 4671068 : 4676870 5 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_346 4685628 : 4686246 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_347 4696149 : 4703798 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_348 4709552 : 4713853 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_349 4727241 : 4728099 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_350 4732167 : 4735953 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_351 4739647 : 4741168 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_352 4761518 : 4770963 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_353 4782969 : 4785003 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_354 4795651 : 4799208 4 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_355 4808346 : 4814448 6 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_356 4827555 : 4828908 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_357 4833634 : 4843855 9 Catovirus(40.0%) NA NA
DBSCAN-SWA_358 4848099 : 4854893 6 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_359 4860895 : 4876934 12 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_360 4884376 : 4885276 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_361 4891473 : 4892640 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_362 4908583 : 4909393 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_363 4919156 : 4919912 1 Escherichia_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP041619
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10982 : 67868 51 Escherichia_phage(42.86%) protease,integrase,transposase attL 3703:3717|attR 11875:11889
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage