Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP019800 Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence 0 crisprs DinG 0 0 0 0
NZ_AP019799 Vibrio rotiferianus strain AM7 chromosome 2 1 crisprs csa3,cas3,cas6f,cas7f,cas5f 0 1 2 0
NZ_AP019798 Vibrio rotiferianus strain AM7 chromosome 1 0 crisprs cas3,DinG,csa3,csx1,DEDDh,cas2,WYL 0 0 5 0

Results visualization

1. NZ_AP019799
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP019799_1 1763423-1763505 Unclear NA
1 spacers
cas6f,cas7f,cas5f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP019799_1 1.1|1763446|37|NZ_AP019799|CRISPRCasFinder 1763446-1763482 37 NZ_AP019800 Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence 27654-27690 7 0.811

1. spacer 1.1|1763446|37|NZ_AP019799|CRISPRCasFinder matches to NZ_AP019800 (Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence) position: , mismatch: 7, identity: 0.811

ggaggaagtttagcagcaccaacgccataattatcag	CRISPR spacer
ggaggaagtttagcagcacgaacgccatagtttattt	Protospacer
******************* *********.**  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1508568 : 1589827 91 Vibrio_phage(76.09%) capsid,portal,integrase,tail,terminase,protease,head,plate,transposase attL 1538894:1538912|attR 1592944:1592962
DBSCAN-SWA_2 1978606 : 2013747 23 uncultured_marine_virus(25.0%) plate,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP019798
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 681103 : 688170 9 Faustovirus(16.67%) NA NA
DBSCAN-SWA_2 761274 : 767964 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_3 984284 : 1053141 58 Vibrio_phage(22.22%) protease,integrase,plate attL 984189:984240|attR 988305:988356
DBSCAN-SWA_4 2495376 : 2558594 55 Prochlorococcus_phage(18.18%) protease,transposase,integrase,tRNA attL 2503763:2503777|attR 2551558:2551572
DBSCAN-SWA_5 2906757 : 2924060 15 uncultured_Mediterranean_phage(18.18%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage