Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP039832 Aeromonas caviae strain WCW1-2 chromosome, complete genome 11 crisprs DEDDh,WYL,c2c9_V-U4,cas3,DinG,cas14j,csa3 14 5 10 1

Results visualization

1. NZ_CP039832
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_1 265806-265903 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_2 394230-394962 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_3 527941-528044 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_4 1020133-1020231 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_5 1504275-1504382 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_6 2213222-2213468 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_7 3824720-3824803 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_8 3972935-3973033 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_9 4096677-4096781 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_10 4300256-4300419 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039832_11 4333500-4333594 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP039832_2 2.3|394341|24|NZ_CP039832|CRT 394341-394364 24 NZ_CP039832.1 397632-397655 0 1.0
NZ_CP039832_2 2.4|394384|34|NZ_CP039832|CRT 394384-394417 34 NZ_CP039832.1 397675-397708 0 1.0
NZ_CP039832_2 2.5|394437|24|NZ_CP039832|CRT 394437-394460 24 NZ_CP039832.1 397728-397751 0 1.0
NZ_CP039832_2 2.6|394480|24|NZ_CP039832|CRT 394480-394503 24 NZ_CP039832.1 397771-397794 0 1.0
NZ_CP039832_2 2.7|394523|24|NZ_CP039832|CRT 394523-394546 24 NZ_CP039832.1 397814-397837 0 1.0
NZ_CP039832_2 2.7|394523|24|NZ_CP039832|CRT 394523-394546 24 NZ_CP039832.1 398082-398105 0 1.0
NZ_CP039832_2 2.9|394609|24|NZ_CP039832|CRT 394609-394632 24 NZ_CP039832.1 397900-397923 0 1.0
NZ_CP039832_2 2.10|394652|24|NZ_CP039832|CRT 394652-394675 24 NZ_CP039832.1 397943-397966 0 1.0
NZ_CP039832_2 2.11|394695|24|NZ_CP039832|CRT 394695-394718 24 NZ_CP039832.1 397900-397923 0 1.0
NZ_CP039832_2 2.12|394738|24|NZ_CP039832|CRT 394738-394761 24 NZ_CP039832.1 397943-397966 0 1.0
NZ_CP039832_2 2.13|394781|24|NZ_CP039832|CRT 394781-394804 24 NZ_CP039832.1 397986-398009 0 1.0
NZ_CP039832_2 2.14|394824|34|NZ_CP039832|CRT 394824-394857 34 NZ_CP039832.1 397581-397614 0 1.0
NZ_CP039832_2 2.14|394824|34|NZ_CP039832|CRT 394824-394857 34 NZ_CP039832.1 398029-398062 0 1.0
NZ_CP039832_2 2.14|394824|34|NZ_CP039832|CRT 394824-394857 34 NZ_CP039832.1 398168-398201 0 1.0
NZ_CP039832_2 2.14|394824|34|NZ_CP039832|CRT 394824-394857 34 NZ_CP039832.1 398393-398426 0 1.0
NZ_CP039832_2 2.15|394877|24|NZ_CP039832|CRT 394877-394900 24 NZ_CP039832.1 397814-397837 0 1.0
NZ_CP039832_2 2.15|394877|24|NZ_CP039832|CRT 394877-394900 24 NZ_CP039832.1 398082-398105 0 1.0
NZ_CP039832_2 2.16|394920|24|NZ_CP039832|CRT 394920-394943 24 NZ_CP039832.1 398125-398148 0 1.0
NZ_CP039832_2 2.16|394920|24|NZ_CP039832|CRT 394920-394943 24 NZ_CP039832.1 398350-398373 0 1.0
NZ_CP039832_2 2.4|394384|34|NZ_CP039832|CRT 394384-394417 34 NZ_CP039832.1 397581-397614 1 0.971
NZ_CP039832_2 2.4|394384|34|NZ_CP039832|CRT 394384-394417 34 NZ_CP039832.1 398029-398062 1 0.971
NZ_CP039832_2 2.4|394384|34|NZ_CP039832|CRT 394384-394417 34 NZ_CP039832.1 398168-398201 1 0.971
NZ_CP039832_2 2.4|394384|34|NZ_CP039832|CRT 394384-394417 34 NZ_CP039832.1 398393-398426 1 0.971
NZ_CP039832_2 2.5|394437|24|NZ_CP039832|CRT 394437-394460 24 NZ_CP039832.1 397814-397837 1 0.958
NZ_CP039832_2 2.5|394437|24|NZ_CP039832|CRT 394437-394460 24 NZ_CP039832.1 398082-398105 1 0.958
NZ_CP039832_2 2.7|394523|24|NZ_CP039832|CRT 394523-394546 24 NZ_CP039832.1 397728-397751 1 0.958
NZ_CP039832_2 2.8|394566|24|NZ_CP039832|CRT 394566-394589 24 NZ_CP039832.1 397857-397880 1 0.958
NZ_CP039832_2 2.10|394652|24|NZ_CP039832|CRT 394652-394675 24 NZ_CP039832.1 398264-398287 1 0.958
NZ_CP039832_2 2.10|394652|24|NZ_CP039832|CRT 394652-394675 24 NZ_CP039832.1 398307-398330 1 0.958
NZ_CP039832_2 2.10|394652|24|NZ_CP039832|CRT 394652-394675 24 NZ_CP039832.1 398489-398512 1 0.958
NZ_CP039832_2 2.10|394652|24|NZ_CP039832|CRT 394652-394675 24 NZ_CP039832.1 398532-398555 1 0.958
NZ_CP039832_2 2.12|394738|24|NZ_CP039832|CRT 394738-394761 24 NZ_CP039832.1 398264-398287 1 0.958
NZ_CP039832_2 2.12|394738|24|NZ_CP039832|CRT 394738-394761 24 NZ_CP039832.1 398307-398330 1 0.958
NZ_CP039832_2 2.12|394738|24|NZ_CP039832|CRT 394738-394761 24 NZ_CP039832.1 398489-398512 1 0.958
NZ_CP039832_2 2.12|394738|24|NZ_CP039832|CRT 394738-394761 24 NZ_CP039832.1 398532-398555 1 0.958
NZ_CP039832_2 2.14|394824|34|NZ_CP039832|CRT 394824-394857 34 NZ_CP039832.1 397675-397708 1 0.971
NZ_CP039832_2 2.15|394877|24|NZ_CP039832|CRT 394877-394900 24 NZ_CP039832.1 397728-397751 1 0.958
NZ_CP039832_2 2.7|394523|24|NZ_CP039832|CRT 394523-394546 24 NZ_CP039832.1 398221-398244 2 0.917
NZ_CP039832_2 2.7|394523|24|NZ_CP039832|CRT 394523-394546 24 NZ_CP039832.1 398446-398469 2 0.917
NZ_CP039832_2 2.10|394652|24|NZ_CP039832|CRT 394652-394675 24 NZ_CP039832.1 398575-398598 2 0.917
NZ_CP039832_2 2.10|394652|24|NZ_CP039832|CRT 394652-394675 24 NZ_CP039832.1 398618-398641 2 0.917
NZ_CP039832_2 2.12|394738|24|NZ_CP039832|CRT 394738-394761 24 NZ_CP039832.1 398575-398598 2 0.917
NZ_CP039832_2 2.12|394738|24|NZ_CP039832|CRT 394738-394761 24 NZ_CP039832.1 398618-398641 2 0.917
NZ_CP039832_2 2.15|394877|24|NZ_CP039832|CRT 394877-394900 24 NZ_CP039832.1 398221-398244 2 0.917
NZ_CP039832_2 2.15|394877|24|NZ_CP039832|CRT 394877-394900 24 NZ_CP039832.1 398446-398469 2 0.917

1. spacer 2.3|394341|24|NZ_CP039832|CRT matches to position: 397632-397655, mismatch: 0, identity: 1.0

cctgactggttcagatagccacta	CRISPR spacer
cctgactggttcagatagccacta	Protospacer
************************

2. spacer 2.4|394384|34|NZ_CP039832|CRT matches to position: 397675-397708, mismatch: 0, identity: 1.0

gtggtgtgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgtgagtgggaggtcgatatgacttcaata	Protospacer
**********************************

3. spacer 2.5|394437|24|NZ_CP039832|CRT matches to position: 397728-397751, mismatch: 0, identity: 1.0

tcgggctggttcagatcgctactg	CRISPR spacer
tcgggctggttcagatcgctactg	Protospacer
************************

4. spacer 2.6|394480|24|NZ_CP039832|CRT matches to position: 397771-397794, mismatch: 0, identity: 1.0

atgagctggttcaagtcgctacta	CRISPR spacer
atgagctggttcaagtcgctacta	Protospacer
************************

5. spacer 2.7|394523|24|NZ_CP039832|CRT matches to position: 397814-397837, mismatch: 0, identity: 1.0

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggttcaggtcgctactg	Protospacer
************************

6. spacer 2.7|394523|24|NZ_CP039832|CRT matches to position: 398082-398105, mismatch: 0, identity: 1.0

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggttcaggtcgctactg	Protospacer
************************

7. spacer 2.9|394609|24|NZ_CP039832|CRT matches to position: 397900-397923, mismatch: 0, identity: 1.0

atgggccgattcaggtcgccactg	CRISPR spacer
atgggccgattcaggtcgccactg	Protospacer
************************

8. spacer 2.10|394652|24|NZ_CP039832|CRT matches to position: 397943-397966, mismatch: 0, identity: 1.0

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgctactg	Protospacer
************************

9. spacer 2.11|394695|24|NZ_CP039832|CRT matches to position: 397900-397923, mismatch: 0, identity: 1.0

atgggccgattcaggtcgccactg	CRISPR spacer
atgggccgattcaggtcgccactg	Protospacer
************************

10. spacer 2.12|394738|24|NZ_CP039832|CRT matches to position: 397943-397966, mismatch: 0, identity: 1.0

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgctactg	Protospacer
************************

11. spacer 2.13|394781|24|NZ_CP039832|CRT matches to position: 397986-398009, mismatch: 0, identity: 1.0

atgggctggttcaggtcgccacta	CRISPR spacer
atgggctggttcaggtcgccacta	Protospacer
************************

12. spacer 2.14|394824|34|NZ_CP039832|CRT matches to position: 397581-397614, mismatch: 0, identity: 1.0

gtggtgcgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgcgagtgggaggtcgatatgacttcaata	Protospacer
**********************************

13. spacer 2.14|394824|34|NZ_CP039832|CRT matches to position: 398029-398062, mismatch: 0, identity: 1.0

gtggtgcgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgcgagtgggaggtcgatatgacttcaata	Protospacer
**********************************

14. spacer 2.14|394824|34|NZ_CP039832|CRT matches to position: 398168-398201, mismatch: 0, identity: 1.0

gtggtgcgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgcgagtgggaggtcgatatgacttcaata	Protospacer
**********************************

15. spacer 2.14|394824|34|NZ_CP039832|CRT matches to position: 398393-398426, mismatch: 0, identity: 1.0

gtggtgcgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgcgagtgggaggtcgatatgacttcaata	Protospacer
**********************************

16. spacer 2.15|394877|24|NZ_CP039832|CRT matches to position: 397814-397837, mismatch: 0, identity: 1.0

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggttcaggtcgctactg	Protospacer
************************

17. spacer 2.15|394877|24|NZ_CP039832|CRT matches to position: 398082-398105, mismatch: 0, identity: 1.0

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggttcaggtcgctactg	Protospacer
************************

18. spacer 2.16|394920|24|NZ_CP039832|CRT matches to position: 398125-398148, mismatch: 0, identity: 1.0

acgggctggttcaggtcgccacta	CRISPR spacer
acgggctggttcaggtcgccacta	Protospacer
************************

19. spacer 2.16|394920|24|NZ_CP039832|CRT matches to position: 398350-398373, mismatch: 0, identity: 1.0

acgggctggttcaggtcgccacta	CRISPR spacer
acgggctggttcaggtcgccacta	Protospacer
************************

20. spacer 2.4|394384|34|NZ_CP039832|CRT matches to position: 397581-397614, mismatch: 1, identity: 0.971

gtggtgtgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgcgagtgggaggtcgatatgacttcaata	Protospacer
******.***************************

21. spacer 2.4|394384|34|NZ_CP039832|CRT matches to position: 398029-398062, mismatch: 1, identity: 0.971

gtggtgtgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgcgagtgggaggtcgatatgacttcaata	Protospacer
******.***************************

22. spacer 2.4|394384|34|NZ_CP039832|CRT matches to position: 398168-398201, mismatch: 1, identity: 0.971

gtggtgtgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgcgagtgggaggtcgatatgacttcaata	Protospacer
******.***************************

23. spacer 2.4|394384|34|NZ_CP039832|CRT matches to position: 398393-398426, mismatch: 1, identity: 0.971

gtggtgtgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgcgagtgggaggtcgatatgacttcaata	Protospacer
******.***************************

24. spacer 2.5|394437|24|NZ_CP039832|CRT matches to position: 397814-397837, mismatch: 1, identity: 0.958

tcgggctggttcagatcgctactg	CRISPR spacer
tcgggctggttcaggtcgctactg	Protospacer
**************.*********

25. spacer 2.5|394437|24|NZ_CP039832|CRT matches to position: 398082-398105, mismatch: 1, identity: 0.958

tcgggctggttcagatcgctactg	CRISPR spacer
tcgggctggttcaggtcgctactg	Protospacer
**************.*********

26. spacer 2.7|394523|24|NZ_CP039832|CRT matches to position: 397728-397751, mismatch: 1, identity: 0.958

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggttcagatcgctactg	Protospacer
**************.*********

27. spacer 2.8|394566|24|NZ_CP039832|CRT matches to position: 397857-397880, mismatch: 1, identity: 0.958

atgaactggttcaagtcgctactg	CRISPR spacer
atgaactggttcaagtcgctattg	Protospacer
*********************.**

28. spacer 2.10|394652|24|NZ_CP039832|CRT matches to position: 398264-398287, mismatch: 1, identity: 0.958

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgccactg	Protospacer
*******************.****

29. spacer 2.10|394652|24|NZ_CP039832|CRT matches to position: 398307-398330, mismatch: 1, identity: 0.958

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgccactg	Protospacer
*******************.****

30. spacer 2.10|394652|24|NZ_CP039832|CRT matches to position: 398489-398512, mismatch: 1, identity: 0.958

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgccactg	Protospacer
*******************.****

31. spacer 2.10|394652|24|NZ_CP039832|CRT matches to position: 398532-398555, mismatch: 1, identity: 0.958

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgccactg	Protospacer
*******************.****

32. spacer 2.12|394738|24|NZ_CP039832|CRT matches to position: 398264-398287, mismatch: 1, identity: 0.958

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgccactg	Protospacer
*******************.****

33. spacer 2.12|394738|24|NZ_CP039832|CRT matches to position: 398307-398330, mismatch: 1, identity: 0.958

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgccactg	Protospacer
*******************.****

34. spacer 2.12|394738|24|NZ_CP039832|CRT matches to position: 398489-398512, mismatch: 1, identity: 0.958

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgccactg	Protospacer
*******************.****

35. spacer 2.12|394738|24|NZ_CP039832|CRT matches to position: 398532-398555, mismatch: 1, identity: 0.958

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgccactg	Protospacer
*******************.****

36. spacer 2.14|394824|34|NZ_CP039832|CRT matches to position: 397675-397708, mismatch: 1, identity: 0.971

gtggtgcgagtgggaggtcgatatgacttcaata	CRISPR spacer
gtggtgtgagtgggaggtcgatatgacttcaata	Protospacer
******.***************************

37. spacer 2.15|394877|24|NZ_CP039832|CRT matches to position: 397728-397751, mismatch: 1, identity: 0.958

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggttcagatcgctactg	Protospacer
**************.*********

38. spacer 2.7|394523|24|NZ_CP039832|CRT matches to position: 398221-398244, mismatch: 2, identity: 0.917

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggtgcaggccgctactg	Protospacer
********** ****.********

39. spacer 2.7|394523|24|NZ_CP039832|CRT matches to position: 398446-398469, mismatch: 2, identity: 0.917

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggtgcaggccgctactg	Protospacer
********** ****.********

40. spacer 2.10|394652|24|NZ_CP039832|CRT matches to position: 398575-398598, mismatch: 2, identity: 0.917

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgcacctg	Protospacer
*******************  ***

41. spacer 2.10|394652|24|NZ_CP039832|CRT matches to position: 398618-398641, mismatch: 2, identity: 0.917

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttctggtcgccactg	Protospacer
************ ******.****

42. spacer 2.12|394738|24|NZ_CP039832|CRT matches to position: 398575-398598, mismatch: 2, identity: 0.917

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttcaggtcgcacctg	Protospacer
*******************  ***

43. spacer 2.12|394738|24|NZ_CP039832|CRT matches to position: 398618-398641, mismatch: 2, identity: 0.917

acgggctggttcaggtcgctactg	CRISPR spacer
acgggctggttctggtcgccactg	Protospacer
************ ******.****

44. spacer 2.15|394877|24|NZ_CP039832|CRT matches to position: 398221-398244, mismatch: 2, identity: 0.917

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggtgcaggccgctactg	Protospacer
********** ****.********

45. spacer 2.15|394877|24|NZ_CP039832|CRT matches to position: 398446-398469, mismatch: 2, identity: 0.917

tcgggctggttcaggtcgctactg	CRISPR spacer
tcgggctggtgcaggccgctactg	Protospacer
********** ****.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP039832_2 2.16|394920|24|NZ_CP039832|CRT 394920-394943 24 MF417867 Uncultured Caudovirales phage clone 3F_7, partial genome 52600-52623 2 0.917
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP026281 Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence 100527-100550 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX147633 Citrobacter freundii strain AMA332 plasmid pT1, complete sequence 112630-112653 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX709966 Pseudomonas aeruginosa strain IP40a plasmid pIP40a, complete sequence 103807-103830 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX832927 Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence 122660-122683 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX786648 Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence 89946-89969 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX869741 Enterobacter cloacae strain 20130723 plasmid R222, complete sequence 86207-86230 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY399978 Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence 100285-100308 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY986974 Citrobacter freundii strain 112298 plasmid p112298-tetA, complete sequence 66438-66461 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY887592 Citrobacter freundii strain Cf52 plasmid pCf52, complete sequence 107638-107661 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY887593 Citrobacter freundii strain Cf53 plasmid pCf53, complete sequence 107638-107661 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY887594 Klebsiella pneumoniae strain Kp55 plasmid pKp55, complete sequence 96618-96641 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_AP023051 Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence 87170-87193 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_022652 Klebsiella pneumoniae strain CRE114 plasmid pIMP-PH114, complete sequence 77646-77669 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN783744 Klebsiella oxytoca plasmid pFDL-VIM, complete sequence 115585-115608 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP033514 Vibrio cholerae strain E4 plasmid pVCR94, complete sequence 50736-50759 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP009414 Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence 92564-92587 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KU726616 Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence 50961-50984 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX458222 Klebsiella pneumoniae strain B2 plasmid pB2-1, complete sequence 83742-83765 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 118302-118325 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KT997783 Escherichia coli strain Y5 plasmid pECY53, complete sequence 105109-105132 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX156772 Escherichia coli strain K-12 plasmid IP40a, complete sequence 106589-106612 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX156773 Escherichia coli strain K-12 plasmid R16a, complete sequence 97832-97855 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KX029331 Klebsiella pneumoniae strain K-109-R plasmid unnamed, complete sequence 109612-109635 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP009411 Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence 101227-101250 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP009413 Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence 61175-61198 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KJ588779 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence 86974-86997 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KJ909290 Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence 88427-88450 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KM083064 Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence 77949-77972 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KR559888 Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence 89601-89624 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KR559889 Klebsiella pneumoniae strain Kpn8143 plasmid pKP-Gr8143, complete sequence 92141-92164 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KJ802405 Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KP742988 Salmonella enterica subsp. enterica serovar Senftenberg strain BCH02406 plasmid pNDM-SAL, complete sequence 29852-29875 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KM670336 Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence 98818-98841 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KR091911 Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence 110234-110257 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KP276584 Escherichia coli strain 39R861 plasmid p39R861-4, complete sequence 75594-75617 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KP975074 Citrobacter freundii strain MRSN11938 plasmid pMRVIM0912, complete sequence 154528-154551 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KR559890 Enterobacter cloacae strain Ecl4873 plasmid pEcl-Gr4873, complete sequence 85362-85385 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KJ802404 Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KP056256 Escherichia coli strain YDC637 plasmid pYDC637, complete sequence 88475-88498 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KP345882 Escherichia coli strain BK32533 plasmid pBK32533, complete sequence 128576-128599 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 AP014611 Serratia marcescens plasmid p11663 DNA, complete sequence, strain: 11663 107547-107570 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 359298-359321 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP025141 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p1, complete sequence 149817-149840 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP032391 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence 56027-56050 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP022126 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence 22719-22742 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP047308 Citrobacter freundii strain L75 plasmid pCf75, complete sequence 98104-98127 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP045742 Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence 83251-83274 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP013324 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-166, complete sequence 151459-151482 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP010373 Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence 46149-46172 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP048305 Escherichia coli strain 9 plasmid p009_A, complete sequence 81935-81958 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP025240 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence 89601-89624 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP024192 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence 92612-92635 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN477204 Escherichia coli strain S15FP06257 plasmid unnamed, complete sequence 170060-170083 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_012885 Aeromonas hydrophila plasmid pRA1, complete sequence 81909-81932 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP027679 Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence 99976-99999 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP017058 Citrobacter freundii strain SL151 plasmid unnamed1, complete sequence 150435-150458 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KC999035 Escherichia coli strain EC2 plasmid pEC2-NDM-3, complete sequence 86974-86997 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_008612 Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence 71619-71642 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP020524 Escherichia coli strain 190 plasmid unnamed1, complete sequence 174037-174060 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP022359 Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence 31295-31318 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT904892 Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2 192174-192197 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP008790 Klebsiella oxytoca KONIH1 plasmid pKOX-86d, complete sequence 110853-110876 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP027038 Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence 64936-64959 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP028316 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence 162474-162497 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 CP009868 Pantoea sp. PSNIH2 plasmid pPSP-100, complete sequence 144222-144245 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP042646 Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence 39476-39499 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP047128 Escherichia coli K-12 plasmid pT-HNK130-3, complete sequence 85676-85699 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031549 Escherichia coli strain cq9 plasmid unnamed3, complete sequence 62757-62780 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 LC556210 Enterobacter cloacae CC23 plasmid pCC23 DNA, complete sequence 122370-122393 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 LC556211 Enterobacter cloacae CC32 plasmid pCC32 DNA, complete sequence 114842-114865 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 LC556212 Klebsiella pneumoniae CC37 plasmid pCC37 DNA, complete sequence 123124-123147 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 LC556213 Escherichia coli S44 plasmid pS44 DNA, complete sequence 123438-123461 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_018994 Escherichia coli plasmid pNDM-1_Dok01, complete sequence 88308-88331 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP022063 Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence 107164-107187 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN175387 Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence 85514-85537 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP014978 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence 90316-90339 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_008613 Photobacterium damselae subsp. piscicida plasmid pP91278, complete sequence 66073-66096 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019045 Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence 86974-86997 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP042479 Citrobacter freundii strain C50 plasmid pC50_001, complete sequence 194412-194435 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031570 Enterobacter hormaechei strain 2013_1a plasmid pIncAC2-1301491, complete sequence 81291-81314 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 123659-123682 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP027055 Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2 64940-64963 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN254970 Escherichia coli strain EC009 plasmid pEC009.1, complete sequence 88918-88941 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 CP052444 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence 116345-116368 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP014658 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence 89601-89624 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019158 Klebsiella pneumoniae plasmid pNDM10469, complete sequence 86974-86997 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019153 Klebsiella pneumoniae plasmid pNDM-KN, complete sequence 133752-133775 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP043190 Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence 21912-21935 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP044142 Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence 26376-26399 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN310375 Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP047421 Shewanella algae strain 18064-CSB-B-B plasmid p18064-65-CSB-B-B, complete sequence 38709-38732 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP025231 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence 101233-101256 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP026552 Citrobacter sp. SL156 plasmid unnamed3 163716-163739 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP018817 Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence 69114-69137 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP038326 Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-3, complete sequence 84106-84129 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP030077 Enterobacter hormaechei strain 20710 plasmid p3-20710, complete sequence 117737-117760 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP041083 Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence 88427-88450 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP043215 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence 21912-21935 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP034714 Salmonella enterica subsp. enterica serovar Mikawasima strain RSE15 plasmid pRSE15, complete sequence 79439-79462 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 KU160531 Vibrio alginolyticus strain VAS3-1 plasmid pVAS3-1, complete sequence 103613-103636 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP038322 Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-2, complete sequence 96975-96998 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP028170 Salmonella enterica strain CFSAN064034 plasmid pGMI17-002_1, complete sequence 147490-147513 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_016974 Providencia stuartii plasmid pMR0211, complete sequence 89547-89570 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP008824 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence 127488-127511 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN310369 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-Ct1/2, complete sequence 91773-91796 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN310370 Klebsiella pneumoniae strain 11935 plasmid p11935-Ct1/2, complete sequence 91774-91797 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 128794-128817 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP021835 Klebsiella pneumoniae strain AR_0120 plasmid tig00000516_pilon, complete sequence 208803-208826 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP021956 Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence 39429-39452 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP009560 Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence 35157-35180 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP041641 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MCR1, complete sequence 141889-141912 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP026207 Escherichia coli strain ECONIH5 plasmid pECO-dc1b, complete sequence 110909-110932 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP036192 Klebsiella pneumoniae strain BA34918 plasmid pIncAC2, complete sequence 113155-113178 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP040024 Klebsiella pneumoniae strain KPC160132 plasmid pIncC-L132, complete sequence 96239-96262 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_023291 Vibrio cholerae strain BI144 plasmid pVCR94deltaX, complete sequence 73869-73892 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP007732 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence 127499-127522 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 88888-88911 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP040039 Klebsiella pneumoniae strain KPC160125 plasmid pIncC-L125 117221-117244 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP040034 Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence 116655-116678 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP038464 Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence 16051-16074 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031610 Escherichia coli strain N3 plasmid pIncAC2-1502318, complete sequence 81291-81314 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031584 Klebsiella pneumoniae strain N4b plasmid pIncAC2-1502320, complete sequence 81297-81320 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP027043 Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence 54139-54162 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP047350 Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence 123070-123093 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_009140 Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence 101233-101256 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031573 Enterobacter hormaechei strain N1 plasmid pIncAC2-1502262, complete sequence 80887-80910 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP012168 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence 111324-111347 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP038466 Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence 142361-142384 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_AP019688 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-1, complete sequence 78270-78293 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_009139 Yersinia ruckeri YR71 plasmid pYR1, complete sequence 88584-88607 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_021667 Klebsiella pneumoniae plasmid IncA/C-LS6, complete sequence 119771-119794 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP047345 Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence 123068-123091 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP047353 Proteus mirabilis strain ZA25 plasmid pZA25-tetX-168kb, complete sequence 120374-120397 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP006661 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence 101069-101092 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP026405 Escherichia coli strain ECONIH4 plasmid pECO-c85f, complete sequence 106070-106093 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_017645 Escherichia coli UMNK88 plasmid pUMNK88, complete sequence 89589-89612 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP009567 Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence 133850-133873 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP029118 Escherichia coli strain AR435 plasmid unnamed5, complete sequence 156790-156813 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP007636 Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence 108493-108516 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP029436 Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence 440750-440773 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP029431 Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence 114310-114333 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP032238 Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence 90809-90832 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031576 Enterobacter hormaechei strain A1 plasmid pIncAC2-1502264, complete sequence 81305-81328 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP024557 Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence 91225-91248 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 CP050164 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP035908 Klebsiella pneumoniae strain BA4656 plasmid pIncAC2, complete sequence 85071-85094 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP024529 Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence 92612-92635 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP018457 Shewanella algae strain CCU101 plasmid unnamed, complete sequence 1413-1436 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MK638972 Escherichia coli J53 plasmid pMG252, complete sequence 58098-58121 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP016013 Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 plasmid pCFSAN003890, complete sequence 111576-111599 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP032491 Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence 72941-72964 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP024522 Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence 92612-92635 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP011540 Klebsiella aerogenes strain G7 plasmid pGPN1, complete sequence 14717-14740 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP015139 Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence 55303-55326 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019065 Escherichia coli plasmid pPG010208, complete sequence 90015-90038 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019066 Escherichia coli plasmid pAPEC1990_61, complete sequence 85841-85864 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019069 Escherichia coli plasmid pNDM10505, complete sequence 86974-86997 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 88918-88941 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP017084 Proteus mirabilis strain T21 plasmid pT212, complete sequence 41885-41908 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP040029 Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence 116655-116678 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 KY014465 Vibrio parahaemolyticus plasmid pVPS114, complete sequence 66775-66798 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 KY014466 Vibrio vulnificus plasmid pVVS1-per1, complete sequence 102259-102282 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031122 Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence 87001-87024 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP019001 Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_KPC, complete sequence 215549-215572 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP023724 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed2, complete sequence 147109-147132 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_016976 Klebsiella pneumoniae plasmid pR55, complete sequence 92418-92441 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP044075 Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence 74598-74621 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP026225 Aeromonas sp. ASNIH3 plasmid pKPC-8e09, complete sequence 103818-103841 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 LC536681 Klebsiella pneumoniae MyNCGM076 plasmid pMyNCGM076, complete sequence 83456-83479 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 LC536682 Klebsiella pneumoniae MyNCGM079 plasmid pMyNCGM079, complete sequence 83456-83479 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 KM506769 Uncultured bacterium plasmid pKAZ1, complete sequence 62395-62418 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP021853 Proteus mirabilis strain AR_0156 plasmid unitig_1, complete sequence 151099-151122 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP017055 Providencia stuartii strain BE2467 plasmid pPS1, complete sequence 49182-49205 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 CP028419 Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence 4392-4415 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP024550 Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence 91225-91248 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN823987 Escherichia coli strain 2016061604 plasmid p6061604-KPC, complete sequence 75654-75677 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 KR827391 Uncultured bacterium plasmid pKAZ2, complete sequence 62472-62495 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 KR827392 Uncultured bacterium plasmid pKAZ3, complete sequence 74410-74433 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 KR827393 Uncultured bacterium plasmid pKAZ4, complete sequence 60081-60104 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 KR827394 Uncultured bacterium plasmid pKAZ5, complete sequence 65110-65133 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP007558 Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence 127488-127511 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP021709 Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence 41443-41466 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP021551 Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence 142935-142958 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN783743 Escherichia coli plasmid pGA_VIM, complete sequence 126842-126865 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_AP018672 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-1, complete sequence 103262-103285 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP011622 Klebsiella pneumoniae strain CAV1344 plasmid pKPC_CAV1344, complete sequence 161470-161493 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 80957-80980 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP041209 Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence 44768-44791 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP014295 Klebsiella pneumoniae strain KP38731 plasmid unnamed1, complete sequence 93352-93375 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP021936 Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence 37529-37552 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031106 Escherichia coli strain AMSCJX02 plasmid pAMSC1, complete sequence 24094-24117 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP012902 Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence 108163-108186 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 60573-60596 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019107 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_174, complete sequence 106877-106900 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019121 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence 79390-79413 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP019053 Escherichia coli strain CRE1540 plasmid p1540-2, complete sequence 107654-107677 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP020056 Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence 61087-61110 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP032192 Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed1, complete sequence 21634-21657 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP026233 Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-0b27, complete sequence 179210-179233 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_012692 Escherichia coli plasmid pAR060302, complete sequence 91289-91312 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_012693 Salmonella enterica plasmid pAM04528, complete sequence 101233-101256 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP015835 Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP024564 Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence 91225-91248 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP046773 Vibrio alginolyticus strain 2014V-1011 plasmid unnamed2, complete sequence 57327-57350 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP014775 Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence 1964-1987 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP034084 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-VIM, complete sequence 68676-68699 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP025245 Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 plasmid pSNE2-2012K-0663, complete sequence 84471-84494 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019375 Providencia stuartii plasmid pTC2, complete sequence 52373-52396 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_019380 Aeromonas hydrophila plasmid pR148, complete sequence 81352-81375 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_023908 Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence 86974-86997 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_022377 Escherichia coli strain SCEC2 plasmid pSCEC2, complete sequence 84239-84262 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP046032 Salmonella sp. HNK130 plasmid pTHNK130-2, complete sequence 42686-42709 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP046034 Salmonella sp. HNK130 plasmid unnamed, complete sequence 62543-62566 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP021695 Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence 25635-25658 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP021952 Klebsiella pneumoniae strain AR_0148 plasmid tig00000169_pilon, complete sequence 2191-2214 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH220284 Aeromonas sp. pRIVM0001_VIM-1 plasmid pRIVM0001_VIM-1_171012_B12, complete sequence 67573-67596 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_023898 Klebsiella pneumoniae plasmid pRMH760, complete sequence 82490-82513 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP040884 Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence 58028-58051 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP025144 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p1, complete sequence 149058-149081 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP025147 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p1, complete sequence 156339-156362 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 LC225353 Photobacterium damselae subsp. piscicida plasmid pP0855 DNA, complete sequence 71619-71642 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_AP018143 Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence 87170-87193 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_AP018145 Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence 96449-96472 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP029718 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed5, complete sequence 133192-133215 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LN831185 Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence 38710-38733 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP031297 Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence 81352-81375 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP048797 Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP015394 Klebsiella pneumoniae strain CR14 plasmid pCR14_2, complete sequence 82262-82285 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 159918-159941 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN550958 Proteus mirabilis strain PRT-ndm plasmid pPM154, complete sequence 151720-151743 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN603981 Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence 87159-87182 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 95035-95058 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT882699 Enterobacter cloacae isolate Enterobacter cloacae ENCL58 plasmid I, complete sequence 135047-135070 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985220 Escherichia coli strain 83 plasmid RCS1TR83_p, complete sequence 145937-145960 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985225 Escherichia coli strain 89 plasmid RCS2TR89_p, complete sequence 41744-41767 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985258 Escherichia coli strain 726 plasmid RCS54TR726_p, complete sequence 108234-108257 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985222 Escherichia coli strain 548 plasmid RCS24TR548_p, complete sequence 136223-136246 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985228 Escherichia coli strain 552 plasmid RCS28TR552_p, complete sequence 95216-95239 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985218 Escherichia coli strain 541 plasmid RCS18TR541_p, complete sequence 42485-42508 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985260 Escherichia coli strain 724 plasmid RCS53TR724_p, complete sequence 50132-50155 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985253 Escherichia coli strain 660 plasmid RCS48TR660_p, complete sequence 98858-98881 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 123675-123698 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985224 Escherichia coli strain 513 plasmid RCS30_p, complete sequence 100609-100632 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985243 Escherichia coli strain 722 plasmid RCS41_p, complete sequence 51307-51330 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 85849-85872 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP018956 Escherichia coli strain Ecol_316 plasmid pEC316_KPC, complete sequence 126949-126972 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN604267 Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence 81352-81375 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN604268 Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence 67608-67631 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MK733575 Escherichia coli strain J53 plasmid pMG252A, complete sequence 201372-201395 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MK388209 Escherichia coli strain Ec20-Lar plasmid pC-Ec20-KPC, complete sequence 144891-144914 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MK439959 Escherichia coli strain Ec-2Lar plasmid pC-Ec2-KPC, complete sequence 182081-182104 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MN101850 Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence 85477-85500 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MN101853 Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence 85477-85500 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MK770642 Klebsiella pneumoniae strain T38 plasmid pT38_MCR3, complete sequence 84183-84206 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MK123268 Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence 88420-88443 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MN148427 Proteus vulgaris strain PV835 plasmid pPV835TEM24, complete sequence 92423-92446 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NC_022522 Salmonella enterica subsp. enterica serovar Kentucky strain 1643/10 plasmid p1643_10, complete sequence 83268-83291 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN657249 Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence 87134-87157 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN657250 Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence 87170-87193 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MN657252 Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH995508 Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence 88420-88443 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH995506 Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence 88420-88443 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH105050 Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence 70945-70968 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH917285 Klebsiella pneumoniae strain 427113 plasmid p427113-Ct1/2, complete sequence 124334-124357 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH909327 Klebsiella pneumoniae strain 526316 plasmid p526316-KPC, complete sequence 85653-85676 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH263652 Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH061195 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-NDM, complete sequence 111805-111828 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH011352 Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence 89543-89566 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH476540 Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence 142476-142499 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MK101346 Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence 85836-85859 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MG764534 Klebsiella aerogenes strain EA409 plasmid pEA409TEM24, complete sequence 86242-86265 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MF627444 Vibrio parahaemolyticus strain Vb0267 plasmid pVb0267, complete sequence 83182-83205 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH001166 Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence 88453-88476 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MF150121 Klebsiella pneumoniae strain A64477 plasmid pKP64477c, complete sequence 36146-36169 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MF150123 Klebsiella pneumoniae strain A64216 plasmid pKP64216b, complete sequence 35087-35110 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MF344573 Klebsiella pneumoniae strain N201205880 plasmid p205880-Ct1/2, complete sequence 88918-88941 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MG228427 Kluyvera cryocrescens strain BO64W plasmid pKC-BO-N1-VIM, complete sequence 67617-67640 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MG450360 Escherichia coli strain AMA566 plasmid pAMA566, complete sequence 88463-88486 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MG252895 Escherichia coli strain Esco-36073cz plasmid pEsco-36073cz, complete sequence 90928-90951 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MG550958 Escherichia coli strain G3216 plasmid pG3216.2, complete sequence 112305-112328 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH113855 Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence 84026-84049 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH457126 Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence 81351-81374 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH325469 Enterobacter hormaechei strain Ec13 plasmid pEc13, complete sequence 185857-185880 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH325468 Enterobacter hormaechei strain Ec09 plasmid pEc09, complete sequence 102212-102235 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH475146 Citrobacter freundii strain 164 plasmid pCf164_LMB-1, complete sequence 34988-35011 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH594478 Citrobacter freundii strain AA593 plasmid pIBAC_Incx3_A/C, complete sequence 93756-93779 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH594477 Citrobacter freundii strain AA535 plasmid pIBAC_IncA/C, complete sequence 94520-94543 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH892479 Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence 88453-88476 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MH844629 Escherichia coli strain 2248 plasmid pNDM-2248, complete sequence 85136-85159 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP030132 Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence 163540-163563 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY887591 Escherichia coli strain Ec19 plasmid pEc19, complete sequence 82354-82377 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY887596 Escherichia coli strain Ec158 plasmid pEc158, complete sequence 86653-86676 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY887590 Escherichia coli strain Ec9 plasmid pEc9, complete sequence 82369-82392 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_KY887595 Escherichia coli strain Ec78 plasmid pEc78, complete sequence 74716-74739 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MF582638 Klebsiella pneumoniae strain KKp4 plasmid pKKp4-VIM, complete sequence 84179-84202 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MF150118 Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence 77621-77644 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MF627445 Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence 83179-83202 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MG053108 Citrobacter freundii strain 33587 plasmid pCf587, complete sequence 80679-80702 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_MF497432 Vibrio alginolyticus strain Vb0506 plasmid pVb0506, complete sequence 86809-86832 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP040068 Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence 91898-91921 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP028814 Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence 78325-78348 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP029442 Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence 85509-85532 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP020913 Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 plasmid pSMO-2010K-0257, complete sequence 82489-82512 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP029737 Providencia rettgeri strain AR_0082 plasmid unnamed, complete sequence 44369-44392 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP048384 Citrobacter freundii strain 62 plasmid p6_B, complete sequence 82298-82321 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP032168 Klebsiella pneumoniae strain AR_0076 plasmid unnamed1, complete sequence 65145-65168 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 NZ_CP053192 Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37b, complete sequence 81355-81378 3 0.875
NZ_CP039832_2 2.1|394249|24|NZ_CP039832|CRT 394249-394272 24 MT151380 Vibrio cholerae strain YA00120881 plasmid pYA00120881, complete sequence 112953-112976 3 0.875
NZ_CP039832_2 2.8|394566|24|NZ_CP039832|CRT 394566-394589 24 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 391853-391876 3 0.875
NZ_CP039832_2 2.8|394566|24|NZ_CP039832|CRT 394566-394589 24 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 639201-639224 3 0.875
NZ_CP039832_2 2.13|394781|24|NZ_CP039832|CRT 394781-394804 24 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 90282-90305 4 0.833
NZ_CP039832_2 2.16|394920|24|NZ_CP039832|CRT 394920-394943 24 NC_027298 Pseudomonas phage LPB1, complate genome 35615-35638 4 0.833
NZ_CP039832_2 2.16|394920|24|NZ_CP039832|CRT 394920-394943 24 KM389244 UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00003 genomic sequence 4819-4842 4 0.833
NZ_CP039832_2 2.16|394920|24|NZ_CP039832|CRT 394920-394943 24 MN536027 Pseudomonas phage vB_Pae-SS2019XII, complete genome 23449-23472 4 0.833
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MG649966 Vibrio virus Ceto, complete genome 81053-81090 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 NC_042094 Vibrio phage Ceto, complete genome 81053-81090 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MG649967 Vibrio virus Thalassa, complete genome 83481-83518 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MT448616 Vibrio phage BBMuffin, complete genome 84299-84336 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MT460518 Vibrio phage Direpillow8, complete genome 83561-83598 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MK907780 Vibrio phage Pontus, complete genome 84152-84189 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 NC_042095 Vibrio phage Thalassa, complete genome 83481-83518 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MN958086 Vibrio phage Bennett, complete genome 83284-83321 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MT448617 Vibrio phage River4, complete genome 83033-83070 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MT459144 Vibrio phage Dax, complete genome 83876-83913 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MT251347 Klebsiella phage LASTA, complete genome 59866-59903 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MT251348 Klebsiella phage SJM3, complete genome 59866-59903 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 NC_047897 Lactobacillus phage Lenus, complete genome 37243-37280 8 0.789
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MW073017 Vibrio phage Va2, complete genome 127682-127719 9 0.763
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 NC_031020 Morganella phage vB_MmoM_MP1, complete genome 65295-65332 9 0.763
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 NZ_CP043618 Sulfurimonas sp. GYSZ_1 plasmid unnamed, complete sequence 16914-16951 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 NZ_CP043618 Sulfurimonas sp. GYSZ_1 plasmid unnamed, complete sequence 19643-19680 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 NC_019529 Vibrio phage pVp-1, complete genome 45227-45264 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MG603697 Vibrio phage Vp_R1, complete genome 41632-41669 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MG592671 Vibrio phage 2.275.O._10N.286.54.E11, partial genome 189775-189812 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 662334-662371 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 NC_031062 Erwinia phage vB_EamP_Frozen, complete genome 41702-41739 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 KX098391 Erwinia phage vB_EamP_Gutmeister, complete genome 37725-37762 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 KX098390 Erwinia phage vB_EamP_Rexella, complete genome 41971-42008 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 KF806588 Erwinia phage Ea9-2, complete genome 41777-41814 10 0.737
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 KY271395 Klebsiella phage 2b LV-2017, complete genome 172-209 11 0.711
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 233-270 11 0.711
NZ_CP039832_6 6.2|2213422|38|NZ_CP039832|PILER-CR 2213422-2213459 38 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 233-270 11 0.711

1. spacer 2.16|394920|24|NZ_CP039832|CRT matches to MF417867 (Uncultured Caudovirales phage clone 3F_7, partial genome) position: , mismatch: 2, identity: 0.917

acgggctggttcaggtcgccacta	CRISPR spacer
acgggctgcttcaggtcgccagta	Protospacer
******** ************ **

2. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP026281 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

3. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX147633 (Citrobacter freundii strain AMA332 plasmid pT1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

4. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX709966 (Pseudomonas aeruginosa strain IP40a plasmid pIP40a, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

5. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

6. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

7. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX869741 (Enterobacter cloacae strain 20130723 plasmid R222, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

8. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY399978 (Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

9. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY986974 (Citrobacter freundii strain 112298 plasmid p112298-tetA, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

10. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY887592 (Citrobacter freundii strain Cf52 plasmid pCf52, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

11. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY887593 (Citrobacter freundii strain Cf53 plasmid pCf53, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

12. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY887594 (Klebsiella pneumoniae strain Kp55 plasmid pKp55, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

13. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

14. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_022652 (Klebsiella pneumoniae strain CRE114 plasmid pIMP-PH114, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

15. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN783744 (Klebsiella oxytoca plasmid pFDL-VIM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

16. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP033514 (Vibrio cholerae strain E4 plasmid pVCR94, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

17. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP009414 (Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

18. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

19. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX458222 (Klebsiella pneumoniae strain B2 plasmid pB2-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

20. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

21. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KT997783 (Escherichia coli strain Y5 plasmid pECY53, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

22. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX156772 (Escherichia coli strain K-12 plasmid IP40a, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

23. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX156773 (Escherichia coli strain K-12 plasmid R16a, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

24. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KX029331 (Klebsiella pneumoniae strain K-109-R plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

25. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP009411 (Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

26. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

27. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

28. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KJ909290 (Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

29. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

30. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KR559888 (Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

31. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KR559889 (Klebsiella pneumoniae strain Kpn8143 plasmid pKP-Gr8143, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

32. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

33. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KP742988 (Salmonella enterica subsp. enterica serovar Senftenberg strain BCH02406 plasmid pNDM-SAL, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

34. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KM670336 (Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

35. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KR091911 (Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

36. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KP276584 (Escherichia coli strain 39R861 plasmid p39R861-4, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

37. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KP975074 (Citrobacter freundii strain MRSN11938 plasmid pMRVIM0912, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

38. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KR559890 (Enterobacter cloacae strain Ecl4873 plasmid pEcl-Gr4873, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

39. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

40. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KP056256 (Escherichia coli strain YDC637 plasmid pYDC637, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

41. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KP345882 (Escherichia coli strain BK32533 plasmid pBK32533, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

42. spacer 2.1|394249|24|NZ_CP039832|CRT matches to AP014611 (Serratia marcescens plasmid p11663 DNA, complete sequence, strain: 11663) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

43. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

44. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP025141 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

45. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP032391 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

46. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

47. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP047308 (Citrobacter freundii strain L75 plasmid pCf75, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

48. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

49. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP013324 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-166, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

50. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

51. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP048305 (Escherichia coli strain 9 plasmid p009_A, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

52. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP025240 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

53. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP024192 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

54. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN477204 (Escherichia coli strain S15FP06257 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

55. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_012885 (Aeromonas hydrophila plasmid pRA1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

56. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP027679 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

57. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP017058 (Citrobacter freundii strain SL151 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

58. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KC999035 (Escherichia coli strain EC2 plasmid pEC2-NDM-3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

59. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_008612 (Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

60. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

61. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP022359 (Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

62. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT904892 (Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

63. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP008790 (Klebsiella oxytoca KONIH1 plasmid pKOX-86d, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

64. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

65. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP028316 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

66. spacer 2.1|394249|24|NZ_CP039832|CRT matches to CP009868 (Pantoea sp. PSNIH2 plasmid pPSP-100, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

67. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP042646 (Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

68. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP047128 (Escherichia coli K-12 plasmid pT-HNK130-3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

69. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031549 (Escherichia coli strain cq9 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

70. spacer 2.1|394249|24|NZ_CP039832|CRT matches to LC556210 (Enterobacter cloacae CC23 plasmid pCC23 DNA, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

71. spacer 2.1|394249|24|NZ_CP039832|CRT matches to LC556211 (Enterobacter cloacae CC32 plasmid pCC32 DNA, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

72. spacer 2.1|394249|24|NZ_CP039832|CRT matches to LC556212 (Klebsiella pneumoniae CC37 plasmid pCC37 DNA, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

73. spacer 2.1|394249|24|NZ_CP039832|CRT matches to LC556213 (Escherichia coli S44 plasmid pS44 DNA, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

74. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

75. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP022063 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

76. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

77. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP014978 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

78. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_008613 (Photobacterium damselae subsp. piscicida plasmid pP91278, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

79. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

80. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP042479 (Citrobacter freundii strain C50 plasmid pC50_001, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

81. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031570 (Enterobacter hormaechei strain 2013_1a plasmid pIncAC2-1301491, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

82. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

83. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

84. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN254970 (Escherichia coli strain EC009 plasmid pEC009.1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

85. spacer 2.1|394249|24|NZ_CP039832|CRT matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

86. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP014658 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

87. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

88. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

89. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP043190 (Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

90. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP044142 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

91. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

92. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP047421 (Shewanella algae strain 18064-CSB-B-B plasmid p18064-65-CSB-B-B, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

93. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP025231 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

94. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP026552 (Citrobacter sp. SL156 plasmid unnamed3) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

95. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

96. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP038326 (Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

97. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP030077 (Enterobacter hormaechei strain 20710 plasmid p3-20710, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

98. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP041083 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

99. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP043215 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

100. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP034714 (Salmonella enterica subsp. enterica serovar Mikawasima strain RSE15 plasmid pRSE15, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

101. spacer 2.1|394249|24|NZ_CP039832|CRT matches to KU160531 (Vibrio alginolyticus strain VAS3-1 plasmid pVAS3-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

102. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP038322 (Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

103. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP028170 (Salmonella enterica strain CFSAN064034 plasmid pGMI17-002_1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

104. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_016974 (Providencia stuartii plasmid pMR0211, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

105. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP008824 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

106. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN310369 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-Ct1/2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

107. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN310370 (Klebsiella pneumoniae strain 11935 plasmid p11935-Ct1/2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

108. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

109. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP021835 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000516_pilon, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

110. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP021956 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

111. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP009560 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

112. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP041641 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MCR1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

113. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP026207 (Escherichia coli strain ECONIH5 plasmid pECO-dc1b, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

114. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP036192 (Klebsiella pneumoniae strain BA34918 plasmid pIncAC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

115. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP040024 (Klebsiella pneumoniae strain KPC160132 plasmid pIncC-L132, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

116. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_023291 (Vibrio cholerae strain BI144 plasmid pVCR94deltaX, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

117. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP007732 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

118. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

119. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP040039 (Klebsiella pneumoniae strain KPC160125 plasmid pIncC-L125) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

120. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

121. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP038464 (Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

122. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031610 (Escherichia coli strain N3 plasmid pIncAC2-1502318, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

123. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031584 (Klebsiella pneumoniae strain N4b plasmid pIncAC2-1502320, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

124. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

125. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP047350 (Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

126. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

127. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031573 (Enterobacter hormaechei strain N1 plasmid pIncAC2-1502262, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

128. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

129. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP038466 (Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

130. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_AP019688 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

131. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_009139 (Yersinia ruckeri YR71 plasmid pYR1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

132. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_021667 (Klebsiella pneumoniae plasmid IncA/C-LS6, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

133. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP047345 (Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

134. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP047353 (Proteus mirabilis strain ZA25 plasmid pZA25-tetX-168kb, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

135. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

136. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP026405 (Escherichia coli strain ECONIH4 plasmid pECO-c85f, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

137. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_017645 (Escherichia coli UMNK88 plasmid pUMNK88, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

138. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP009567 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

139. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

140. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP007636 (Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

141. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP029436 (Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

142. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP029431 (Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

143. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP032238 (Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

144. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031576 (Enterobacter hormaechei strain A1 plasmid pIncAC2-1502264, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

145. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP024557 (Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

146. spacer 2.1|394249|24|NZ_CP039832|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

147. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP035908 (Klebsiella pneumoniae strain BA4656 plasmid pIncAC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

148. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP024529 (Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

149. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP018457 (Shewanella algae strain CCU101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

150. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MK638972 (Escherichia coli J53 plasmid pMG252, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

151. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP016013 (Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 plasmid pCFSAN003890, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

152. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

153. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP024522 (Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

154. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP011540 (Klebsiella aerogenes strain G7 plasmid pGPN1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

155. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP015139 (Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

156. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019065 (Escherichia coli plasmid pPG010208, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

157. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

158. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

159. spacer 2.1|394249|24|NZ_CP039832|CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

160. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

161. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

162. spacer 2.1|394249|24|NZ_CP039832|CRT matches to KY014465 (Vibrio parahaemolyticus plasmid pVPS114, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

163. spacer 2.1|394249|24|NZ_CP039832|CRT matches to KY014466 (Vibrio vulnificus plasmid pVVS1-per1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

164. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

165. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP019001 (Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_KPC, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

166. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP023724 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

167. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_016976 (Klebsiella pneumoniae plasmid pR55, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

168. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP044075 (Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

169. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP026225 (Aeromonas sp. ASNIH3 plasmid pKPC-8e09, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

170. spacer 2.1|394249|24|NZ_CP039832|CRT matches to LC536681 (Klebsiella pneumoniae MyNCGM076 plasmid pMyNCGM076, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

171. spacer 2.1|394249|24|NZ_CP039832|CRT matches to LC536682 (Klebsiella pneumoniae MyNCGM079 plasmid pMyNCGM079, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

172. spacer 2.1|394249|24|NZ_CP039832|CRT matches to KM506769 (Uncultured bacterium plasmid pKAZ1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

173. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP021853 (Proteus mirabilis strain AR_0156 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

174. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP017055 (Providencia stuartii strain BE2467 plasmid pPS1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

175. spacer 2.1|394249|24|NZ_CP039832|CRT matches to CP028419 (Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

176. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP024550 (Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

177. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN823987 (Escherichia coli strain 2016061604 plasmid p6061604-KPC, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

178. spacer 2.1|394249|24|NZ_CP039832|CRT matches to KR827391 (Uncultured bacterium plasmid pKAZ2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

179. spacer 2.1|394249|24|NZ_CP039832|CRT matches to KR827392 (Uncultured bacterium plasmid pKAZ3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

180. spacer 2.1|394249|24|NZ_CP039832|CRT matches to KR827393 (Uncultured bacterium plasmid pKAZ4, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

181. spacer 2.1|394249|24|NZ_CP039832|CRT matches to KR827394 (Uncultured bacterium plasmid pKAZ5, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

182. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP007558 (Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

183. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP021709 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

184. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP021551 (Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

185. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN783743 (Escherichia coli plasmid pGA_VIM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

186. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_AP018672 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

187. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP011622 (Klebsiella pneumoniae strain CAV1344 plasmid pKPC_CAV1344, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

188. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

189. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP041209 (Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

190. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP014295 (Klebsiella pneumoniae strain KP38731 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

191. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

192. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031106 (Escherichia coli strain AMSCJX02 plasmid pAMSC1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

193. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP012902 (Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

194. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

195. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019107 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_174, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

196. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019121 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

197. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP019053 (Escherichia coli strain CRE1540 plasmid p1540-2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

198. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

199. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP032192 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

200. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP026233 (Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-0b27, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

201. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

202. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_012693 (Salmonella enterica plasmid pAM04528, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

203. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

204. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP024564 (Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

205. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP046773 (Vibrio alginolyticus strain 2014V-1011 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

206. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP014775 (Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

207. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP034084 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-VIM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

208. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP025245 (Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 plasmid pSNE2-2012K-0663, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

209. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019375 (Providencia stuartii plasmid pTC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

210. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_019380 (Aeromonas hydrophila plasmid pR148, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

211. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

212. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_022377 (Escherichia coli strain SCEC2 plasmid pSCEC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

213. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP046032 (Salmonella sp. HNK130 plasmid pTHNK130-2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

214. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP046034 (Salmonella sp. HNK130 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

215. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP021695 (Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

216. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP021952 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000169_pilon, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

217. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH220284 (Aeromonas sp. pRIVM0001_VIM-1 plasmid pRIVM0001_VIM-1_171012_B12, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

218. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_023898 (Klebsiella pneumoniae plasmid pRMH760, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

219. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

220. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP025144 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

221. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP025147 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

222. spacer 2.1|394249|24|NZ_CP039832|CRT matches to LC225353 (Photobacterium damselae subsp. piscicida plasmid pP0855 DNA, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

223. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

224. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

225. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP029718 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

226. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LN831185 (Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

227. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

228. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

229. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP015394 (Klebsiella pneumoniae strain CR14 plasmid pCR14_2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

230. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

231. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN550958 (Proteus mirabilis strain PRT-ndm plasmid pPM154, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

232. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

233. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

234. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT882699 (Enterobacter cloacae isolate Enterobacter cloacae ENCL58 plasmid I, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

235. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985220 (Escherichia coli strain 83 plasmid RCS1TR83_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

236. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985225 (Escherichia coli strain 89 plasmid RCS2TR89_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

237. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985258 (Escherichia coli strain 726 plasmid RCS54TR726_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

238. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985222 (Escherichia coli strain 548 plasmid RCS24TR548_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

239. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985228 (Escherichia coli strain 552 plasmid RCS28TR552_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

240. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985218 (Escherichia coli strain 541 plasmid RCS18TR541_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

241. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985260 (Escherichia coli strain 724 plasmid RCS53TR724_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

242. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985253 (Escherichia coli strain 660 plasmid RCS48TR660_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

243. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

244. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985224 (Escherichia coli strain 513 plasmid RCS30_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

245. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985243 (Escherichia coli strain 722 plasmid RCS41_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

246. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

247. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP018956 (Escherichia coli strain Ecol_316 plasmid pEC316_KPC, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

248. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

249. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

250. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MK733575 (Escherichia coli strain J53 plasmid pMG252A, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

251. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MK388209 (Escherichia coli strain Ec20-Lar plasmid pC-Ec20-KPC, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

252. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MK439959 (Escherichia coli strain Ec-2Lar plasmid pC-Ec2-KPC, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

253. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

254. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MN101853 (Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

255. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MK770642 (Klebsiella pneumoniae strain T38 plasmid pT38_MCR3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

256. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

257. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MN148427 (Proteus vulgaris strain PV835 plasmid pPV835TEM24, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

258. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NC_022522 (Salmonella enterica subsp. enterica serovar Kentucky strain 1643/10 plasmid p1643_10, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

259. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

260. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

261. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MN657252 (Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

262. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

263. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

264. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

265. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH917285 (Klebsiella pneumoniae strain 427113 plasmid p427113-Ct1/2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

266. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH909327 (Klebsiella pneumoniae strain 526316 plasmid p526316-KPC, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

267. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

268. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH061195 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

269. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH011352 (Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

270. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

271. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

272. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MG764534 (Klebsiella aerogenes strain EA409 plasmid pEA409TEM24, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

273. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MF627444 (Vibrio parahaemolyticus strain Vb0267 plasmid pVb0267, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

274. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH001166 (Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

275. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MF150121 (Klebsiella pneumoniae strain A64477 plasmid pKP64477c, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

276. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MF150123 (Klebsiella pneumoniae strain A64216 plasmid pKP64216b, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

277. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MF344573 (Klebsiella pneumoniae strain N201205880 plasmid p205880-Ct1/2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

278. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MG228427 (Kluyvera cryocrescens strain BO64W plasmid pKC-BO-N1-VIM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

279. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MG450360 (Escherichia coli strain AMA566 plasmid pAMA566, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

280. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MG252895 (Escherichia coli strain Esco-36073cz plasmid pEsco-36073cz, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

281. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MG550958 (Escherichia coli strain G3216 plasmid pG3216.2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

282. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH113855 (Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

283. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

284. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH325469 (Enterobacter hormaechei strain Ec13 plasmid pEc13, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

285. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH325468 (Enterobacter hormaechei strain Ec09 plasmid pEc09, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

286. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH475146 (Citrobacter freundii strain 164 plasmid pCf164_LMB-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

287. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH594478 (Citrobacter freundii strain AA593 plasmid pIBAC_Incx3_A/C, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

288. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH594477 (Citrobacter freundii strain AA535 plasmid pIBAC_IncA/C, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

289. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH892479 (Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

290. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MH844629 (Escherichia coli strain 2248 plasmid pNDM-2248, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

291. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

292. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY887591 (Escherichia coli strain Ec19 plasmid pEc19, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

293. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY887596 (Escherichia coli strain Ec158 plasmid pEc158, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

294. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY887590 (Escherichia coli strain Ec9 plasmid pEc9, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

295. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_KY887595 (Escherichia coli strain Ec78 plasmid pEc78, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

296. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MF582638 (Klebsiella pneumoniae strain KKp4 plasmid pKKp4-VIM, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

297. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

298. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

299. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MG053108 (Citrobacter freundii strain 33587 plasmid pCf587, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

300. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_MF497432 (Vibrio alginolyticus strain Vb0506 plasmid pVb0506, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

301. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP040068 (Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

302. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP028814 (Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

303. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP029442 (Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

304. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP020913 (Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 plasmid pSMO-2010K-0257, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

305. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP029737 (Providencia rettgeri strain AR_0082 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

306. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP048384 (Citrobacter freundii strain 62 plasmid p6_B, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

307. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP032168 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

308. spacer 2.1|394249|24|NZ_CP039832|CRT matches to NZ_CP053192 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37b, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

309. spacer 2.1|394249|24|NZ_CP039832|CRT matches to MT151380 (Vibrio cholerae strain YA00120881 plasmid pYA00120881, complete sequence) position: , mismatch: 3, identity: 0.875

cctggctggttcaggttgccacta	CRISPR spacer
actggctggttccggttgccacca	Protospacer
 *********** *********.*

310. spacer 2.8|394566|24|NZ_CP039832|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

atgaactggttcaagtcgctactg	CRISPR spacer
atgaactggttcatgtcgctatgg	Protospacer
************* *******. *

311. spacer 2.8|394566|24|NZ_CP039832|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.875

atgaactggttcaagtcgctactg	CRISPR spacer
atgaactggttcatgtcgctatgg	Protospacer
************* *******. *

312. spacer 2.13|394781|24|NZ_CP039832|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 4, identity: 0.833

atgggctggttcaggtcgccacta	CRISPR spacer
ctgggctggttcaggtcgccgatc	Protospacer
 *******************. * 

313. spacer 2.16|394920|24|NZ_CP039832|CRT matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 4, identity: 0.833

acgggctggttcaggtcgccacta	CRISPR spacer
acgcgctggttcaggtcgccagcc	Protospacer
*** ***************** . 

314. spacer 2.16|394920|24|NZ_CP039832|CRT matches to KM389244 (UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00003 genomic sequence) position: , mismatch: 4, identity: 0.833

acgggctggttcaggtcgccacta	CRISPR spacer
acgcgctggttcaggtcgccagcc	Protospacer
*** ***************** . 

315. spacer 2.16|394920|24|NZ_CP039832|CRT matches to MN536027 (Pseudomonas phage vB_Pae-SS2019XII, complete genome) position: , mismatch: 4, identity: 0.833

acgggctggttcaggtcgccacta	CRISPR spacer
acgcgctggttcaggtcgccagcc	Protospacer
*** ***************** . 

316. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MG649966 (Vibrio virus Ceto, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattaatttg	Protospacer
 ******** ***************.***** *    *

317. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to NC_042094 (Vibrio phage Ceto, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattaatttg	Protospacer
 ******** ***************.***** *    *

318. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MG649967 (Vibrio virus Thalassa, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattattttg	Protospacer
 ******** ***************.***** *.   *

319. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MT448616 (Vibrio phage BBMuffin, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattaatttg	Protospacer
 ******** ***************.***** *    *

320. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MT460518 (Vibrio phage Direpillow8, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattaatttg	Protospacer
 ******** ***************.***** *    *

321. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MK907780 (Vibrio phage Pontus, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattaatttg	Protospacer
 ******** ***************.***** *    *

322. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to NC_042095 (Vibrio phage Thalassa, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattattttg	Protospacer
 ******** ***************.***** *.   *

323. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MN958086 (Vibrio phage Bennett, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattaatttg	Protospacer
 ******** ***************.***** *    *

324. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MT448617 (Vibrio phage River4, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattattttg	Protospacer
 ******** ***************.***** *.   *

325. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MT459144 (Vibrio phage Dax, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcattaatttg	Protospacer
 ******** ***************.***** *    *

326. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MT251347 (Klebsiella phage LASTA, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
gttgctctatccagctgagctaagggcgcattgttgtg	Protospacer
* ******* ***************.***** .. * *

327. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MT251348 (Klebsiella phage SJM3, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
gttgctctatccagctgagctaagggcgcattgttgtg	Protospacer
* ******* ***************.***** .. * *

328. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to NC_047897 (Lactobacillus phage Lenus, complete genome) position: , mismatch: 8, identity: 0.789

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
gttgctctatccagttgagctaaggacgcagtatacag	Protospacer
* ******* ****.***************  *.* .*

329. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MW073017 (Vibrio phage Va2, complete genome) position: , mismatch: 9, identity: 0.763

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcatgaactac	Protospacer
 ******** ***************.*****.*   . 

330. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to NC_031020 (Morganella phage vB_MmoM_MP1, complete genome) position: , mismatch: 9, identity: 0.763

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
gatgctctaaccagctgagctaacgacgcgatactatt	Protospacer
*.********************* *****.  ** .  

331. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to NZ_CP043618 (Sulfurimonas sp. GYSZ_1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
agtgctctatccagctgagctatggacgcattcattat	Protospacer
.******** ************ ********     . 

332. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to NZ_CP043618 (Sulfurimonas sp. GYSZ_1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
agtgctctatccagctgagctatggacgcattcattat	Protospacer
.******** ************ ********     . 

333. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to NC_019529 (Vibrio phage pVp-1, complete genome) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
cgtgctctatccagctgagctaagggcgcatttgttta	Protospacer
 ******** ***************.*****      .

334. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MG603697 (Vibrio phage Vp_R1, complete genome) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
tacgctctatccagctgagctaagggcgcataattctt	Protospacer
 ..****** ***************.*******.    

335. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MG592671 (Vibrio phage 2.275.O._10N.286.54.E11, partial genome) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
tatgctctatccagctgagctaagggcgcaacaaacaa	Protospacer
 .******* ***************.****  * * ..

336. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
gttgctctatccagctgagctaagggcgcactgagaag	Protospacer
* ******* ***************.****. . ...*

337. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to NC_031062 (Erwinia phage vB_EamP_Frozen, complete genome) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
ggtgctctaaccaactgagctaacgacctgaagatgga	Protospacer
*************.********* *** .. *.  **.

338. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to KX098391 (Erwinia phage vB_EamP_Gutmeister, complete genome) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
ggtgctctaaccaactgagctaacgacctgaagatgga	Protospacer
*************.********* *** .. *.  **.

339. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to KX098390 (Erwinia phage vB_EamP_Rexella, complete genome) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
ggtgctctaaccaactgagctaacgacctgaagatgga	Protospacer
*************.********* *** .. *.  **.

340. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 10, identity: 0.737

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
ggtgctctaaccaactgagctaacgacctgaagatgga	Protospacer
*************.********* *** .. *.  **.

341. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 11, identity: 0.711

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
gttgctctatccagctgagctaagggcgccctgagaag	Protospacer
* ******* ***************.*** . . ...*

342. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 11, identity: 0.711

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
gttgctctatccagctgagctaagggcgccctgagaag	Protospacer
* ******* ***************.*** . . ...*

343. spacer 6.2|2213422|38|NZ_CP039832|PILER-CR matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 11, identity: 0.711

ggtgctctaaccagctgagctaaggacgcataacaggg	CRISPR spacer
gttgctctatccagctgagctaagggcgccctgagaag	Protospacer
* ******* ***************.*** . . ...*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20697 : 79303 48 Escherichia_phage(25.0%) integrase,transposase,tRNA attL 8873:8889|attR 36600:36616
DBSCAN-SWA_2 369837 : 405985 31 Acidithiobacillus_phage(25.0%) integrase,transposase attL 355628:355643|attR 414148:414163
DBSCAN-SWA_3 754476 : 764445 10 uncultured_Mediterranean_phage(25.0%) tRNA NA
DBSCAN-SWA_4 1378558 : 1440823 71 Aeromonas_phage(80.36%) integrase,terminase attL 1378256:1378270|attR 1410596:1410610
DBSCAN-SWA_5 1989900 : 2045142 45 uncultured_Mediterranean_phage(12.5%) transposase,integrase,protease,tRNA,bacteriocin attL 1997704:1997721|attR 2047667:2047684
DBSCAN-SWA_6 2350007 : 2410373 52 Escherichia_phage(23.08%) integrase,transposase,protease,tRNA attL 2380248:2380262|attR 2408160:2408174
DBSCAN-SWA_7 2585026 : 2666965 57 Enterococcus_phage(18.18%) transposase NA
DBSCAN-SWA_8 2761298 : 2768954 8 Mycoplasma_phage(33.33%) NA NA
DBSCAN-SWA_9 3013756 : 3080605 60 Prochlorococcus_phage(27.27%) transposase,tRNA NA
DBSCAN-SWA_10 4480580 : 4544933 50 Escherichia_phage(25.0%) transposase,tRNA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP039832.1|WP_000376617.1|387074_387317_+|hypothetical-protein 387074_387317_+ 80 aa aa NA NA NA 369837-405985 yes