Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041513 Shigella boydii strain KCCM 41690 chromosome, complete genome 3 crisprs DEDDh,cas3,DinG,cas5,cas6e,cas2,csa3,c2c9_V-U4 0 2 21 0
NZ_CP041512 Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence 0 crisprs RT 0 0 1 0

Results visualization

1. NZ_CP041513
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041513_1 2820404-2820545 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041513_2 2905443-2905558 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041513_3 2971441-2971572 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041513_2 2.1|2905474|54|NZ_CP041513|CRISPRCasFinder 2905474-2905527 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
NZ_CP041513_1 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder 2820445-2820504 60 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4158-4217 8 0.867
NZ_CP041513_1 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder 2820445-2820504 60 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4157-4216 8 0.867
NZ_CP041513_1 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder 2820445-2820504 60 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 115798-115857 8 0.867
NZ_CP041513_1 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder 2820445-2820504 60 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4157-4216 8 0.867
NZ_CP041513_1 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder 2820445-2820504 60 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4157-4216 8 0.867
NZ_CP041513_1 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder 2820445-2820504 60 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7435-7494 11 0.817
NZ_CP041513_1 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder 2820445-2820504 60 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84259-84318 11 0.817
NZ_CP041513_2 2.1|2905474|54|NZ_CP041513|CRISPRCasFinder 2905474-2905527 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
NZ_CP041513_1 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder 2820445-2820504 60 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40377-40436 14 0.767

1. spacer 2.1|2905474|54|NZ_CP041513|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981

gaatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	CRISPR spacer
caatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	Protospacer
 *****************************************************

2. spacer 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

3. spacer 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

4. spacer 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

5. spacer 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

6. spacer 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.867

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

7. spacer 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 11, identity: 0.817

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgcac	CRISPR spacer
aaactgcactcaaccgtaggccggataaggcgttcacgccgcatccggcaatt-gtgcac	Protospacer
.. .**..*. ***************************************.** *.****

8. spacer 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 11, identity: 0.817

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgcac	CRISPR spacer
aaactgcactcaaccgtaggccggataaggcgttcacgccgcatccggcaatt-gtgcac	Protospacer
.. .**..*. ***************************************.** *.****

9. spacer 2.1|2905474|54|NZ_CP041513|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778

gaatgccggatgcgctttgcttatccggcctacaaaatcgc-----agcgtgtaggcca	CRISPR spacer
tactgccggatgcgctttgcttatccggcctacaataccgcgaattaatttgta-----	Protospacer
 * ******************************** *.***     *.. ****     

10. spacer 1.1|2820445|60|NZ_CP041513|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.767

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttgg-cgca	CRISPR spacer
cactcgcaccaaaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgta	Protospacer
 ..*.*..**.***********************.***************.  .* **.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25261 : 182059 122 Stx2-converting_phage(13.51%) tRNA,transposase,protease,integrase attL 99664:99723|attR 164847:165184
DBSCAN-SWA_2 347542 : 427606 59 Stx2-converting_phage(35.71%) tRNA,transposase,protease NA
DBSCAN-SWA_3 450650 : 512319 54 Salmonella_phage(26.92%) tRNA,tail,protease NA
DBSCAN-SWA_4 557571 : 652254 77 Stx2-converting_phage(26.67%) tail,transposase NA
DBSCAN-SWA_5 726172 : 804185 60 Stx2-converting_phage(30.77%) tRNA,transposase NA
DBSCAN-SWA_6 926054 : 987123 56 Stx2-converting_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_7 1221659 : 1289356 51 Shigella_phage(33.33%) holin,transposase,protease NA
DBSCAN-SWA_8 1792876 : 1853272 54 Stx2-converting_phage(27.78%) transposase NA
DBSCAN-SWA_9 2509603 : 2642336 100 Stx2-converting_phage(44.74%) tRNA,transposase,protease NA
DBSCAN-SWA_10 3050968 : 3111069 53 Shigella_phage(22.73%) tRNA,holin,transposase NA
DBSCAN-SWA_11 3510872 : 3528833 17 Stx2-converting_phage(37.5%) tail,transposase,integrase attL 3509451:3509466|attR 3529781:3529796
DBSCAN-SWA_12 3625719 : 3665392 31 Enterobacteria_phage(54.55%) tRNA,tail,transposase,lysis NA
DBSCAN-SWA_13 3672647 : 3719759 48 Enterobacteria_phage(34.21%) terminase,tail,lysis,head,transposase NA
DBSCAN-SWA_14 3744148 : 3785197 30 Stx2-converting_phage(27.27%) tail,transposase,integrase attL 3737098:3737157|attR 3763995:3764757
DBSCAN-SWA_15 3815189 : 3862484 50 Stx2-converting_phage(30.43%) tRNA,tail,transposase NA
DBSCAN-SWA_16 3931814 : 3939353 7 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_17 3969737 : 4003317 42 Enterobacteria_phage(56.25%) holin,transposase,lysis NA
DBSCAN-SWA_18 4193096 : 4231824 27 Shigella_phage(20.0%) tRNA,transposase NA
DBSCAN-SWA_19 4261071 : 4298370 35 Stx2-converting_phage(55.56%) transposase NA
DBSCAN-SWA_20 4309554 : 4387475 52 Shigella_phage(33.33%) transposase NA
DBSCAN-SWA_21 4484453 : 4560979 67 Enterobacteria_phage(50.0%) tail,terminase,plate,integrase,transposase attL 4491884:4491943|attR 4550900:4551667
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP041512
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2677 : 82376 58 Stx2-converting_phage(36.84%) transposase,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage