Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040642 Agrobacterium sp. T29 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP040641 Agrobacterium sp. T29 chromosome linear, complete sequence 1 crisprs csa3,DEDDh 0 0 1 0
NZ_CP040640 Agrobacterium sp. T29 chromosome circular, complete sequence 1 crisprs WYL,DEDDh,csa3,cas3 0 1 3 0

Results visualization

1. NZ_CP040641
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040641_1 1459265-1459571 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 742169 : 762379 31 Ochrobactrum_phage(50.0%) transposase,integrase attL 734853:734869|attR 765396:765412
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP040640
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040640_1 1383426-1383505 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 HQ331142 Salmonella phage S16, complete genome 92743-92776 8 0.765
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1761529-1761562 9 0.735
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1224348-1224381 9 0.735
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 110083-110116 9 0.735
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 JX181825 Salmonella phage STML-198, complete genome 134228-134261 9 0.735
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 KJ000058 Salmonella phage STP4-a, complete genome 93822-93855 9 0.735
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 NC_042044 Salmonella phage Melville, complete genome 94122-94155 9 0.735
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1248601-1248634 10 0.706
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 850917-850950 10 0.706
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1160346-1160379 10 0.706
NZ_CP040640_1 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder 1383449-1383482 34 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 670407-670440 10 0.706

1. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to HQ331142 (Salmonella phage S16, complete genome) position: , mismatch: 8, identity: 0.765

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ctcatcttcgtcatcgccttcatcggcgtcgtca	Protospacer
*  * *  * ** ********* ***********

2. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ctttactacttcttcgccttcggcggcttcgtcg	Protospacer
*   .* .*************.***** *****.

3. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ctctactacttcttcgccttcggcggcttcgtcg	Protospacer
*   .* .*************.***** *****.

4. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 9, identity: 0.735

cggagcggct--tcttcgccttcagcggcgtcgtca	CRISPR spacer
--caccagtcgatcttcgccttccgcggcgccgtca	Protospacer
   * *.*..  *********** ******.*****

5. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to JX181825 (Salmonella phage STML-198, complete genome) position: , mismatch: 9, identity: 0.735

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ttcatcttcgtcatcgccttcatcggcgtcgtca	Protospacer
.  * *  * ** ********* ***********

6. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to KJ000058 (Salmonella phage STP4-a, complete genome) position: , mismatch: 9, identity: 0.735

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ttcatcttcgtcatcgccttcatcggcgtcgtca	Protospacer
.  * *  * ** ********* ***********

7. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to NC_042044 (Salmonella phage Melville, complete genome) position: , mismatch: 9, identity: 0.735

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ttcatcttcgtcatcgccttcatcggcgtcgtca	Protospacer
.  * *  * ** ********* ***********

8. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ctctactatttcttcgccttcggcggcttcgtcg	Protospacer
*   .* ..************.***** *****.

9. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 10, identity: 0.706

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ctctactatttcttcgccttcggcggcttcgtcg	Protospacer
*   .* ..************.***** *****.

10. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ctctactatttcttcgccttcggcggcttcgtcg	Protospacer
*   .* ..************.***** *****.

11. spacer 1.1|1383449|34|NZ_CP040640|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.706

cggagcggcttcttcgccttcagcggcgtcgtca	CRISPR spacer
ctctactatttcttcgccttcggcggcttcgtcg	Protospacer
*   .* ..************.***** *****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 638318 : 645650 11 Geobacillus_phage(33.33%) protease,head,tail,portal,capsid NA
DBSCAN-SWA_2 1394020 : 1402298 8 uncultured_Mediterranean_phage(66.67%) tRNA NA
DBSCAN-SWA_3 1418701 : 1427257 9 uncultured_Mediterranean_phage(75.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage