Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021395 Bordetella hinzii strain SV2 chromosome, complete genome 3 crisprs csa3,WYL,DEDDh,DinG 1 2 364 0

Results visualization

1. NZ_CP021395
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021395_1 2680258-2680359 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021395_2 2680438-2680578 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021395_3 2680663-2680892 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP021395_2 2.1|2680461|16|NZ_CP021395|CRISPRCasFinder 2680461-2680476 16 NZ_CP021395.1 3662921-3662936 0 1.0

1. spacer 2.1|2680461|16|NZ_CP021395|CRISPRCasFinder matches to position: 3662921-3662936, mismatch: 0, identity: 1.0

ttggaggcgccgccgc	CRISPR spacer
ttggaggcgccgccgc	Protospacer
****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021395_3 3.2|2680728|25|NZ_CP021395|CRISPRCasFinder 2680728-2680752 25 NC_012987 Methylorubrum extorquens AM1 plasmid p1METDI, complete sequence 116740-116764 2 0.92
NZ_CP021395_3 3.2|2680728|25|NZ_CP021395|CRISPRCasFinder 2680728-2680752 25 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 151581-151605 4 0.84
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 45761-45791 7 0.774
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 354803-354833 8 0.742
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP036488 Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence 4539-4569 8 0.742
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP032297 Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence 35678-35708 8 0.742
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 45450-45480 8 0.742
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 45311-45341 8 0.742
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP034838 Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence 45408-45438 8 0.742
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP034839 Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence 45408-45438 8 0.742
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP034837 Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence 45313-45343 8 0.742
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP053443 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eC, complete sequence 129196-129226 9 0.71
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 550932-550962 9 0.71
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 299300-299330 10 0.677
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP049319 Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence 553242-553272 10 0.677
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 291814-291844 10 0.677
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 299484-299514 10 0.677
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 748834-748864 10 0.677
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 179921-179951 10 0.677
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP034542 Brevibacillus sp. SCSIO 07484 plasmid unnamed, complete sequence 37792-37822 10 0.677
NZ_CP021395_3 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder 2680839-2680869 31 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 437444-437474 10 0.677

1. spacer 3.2|2680728|25|NZ_CP021395|CRISPRCasFinder matches to NC_012987 (Methylorubrum extorquens AM1 plasmid p1METDI, complete sequence) position: , mismatch: 2, identity: 0.92

ccggcgctgccgcctgtttggggcg	CRISPR spacer
ccggcgccgccgcctgtttgggggg	Protospacer
*******.*************** *

2. spacer 3.2|2680728|25|NZ_CP021395|CRISPRCasFinder matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 4, identity: 0.84

ccggcgctgccgcctgtttggggcg	CRISPR spacer
gcggcgctgccgcctgttggggctg	Protospacer
 ***************** *** .*

3. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 7, identity: 0.774

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
tcgccggtcgcgtcgccggcgttctacgggc	Protospacer
.******.***** ********** * * * 

4. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgctggccgcgtggccggcgttcgtttccg	Protospacer
****.********.**********.   . *

5. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP036488 (Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgcccgccgcgtaaccggcgttgcgcatga	Protospacer
***** ********.********  . .**.

6. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP032297 (Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgcccgccgcgtaaccggcgttgcgcatga	Protospacer
***** ********.********  . .**.

7. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgcccgccgcgtaaccggcgttgcgcatga	Protospacer
***** ********.********  . .**.

8. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgcccgccgcgtaaccggcgttgcgcatga	Protospacer
***** ********.********  . .**.

9. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgcccgccgcgtaaccggcgttgcgcatga	Protospacer
***** ********.********  . .**.

10. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgcccgccgcgtaaccggcgttgcgcatga	Protospacer
***** ********.********  . .**.

11. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP034837 (Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgcccgccgcgtaaccggcgttgcgcatga	Protospacer
***** ********.********  . .**.

12. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP053443 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eC, complete sequence) position: , mismatch: 9, identity: 0.71

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgccggccgcattgccggcgttgccaattc	Protospacer
***********.* *********   ..*  

13. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
acgccgtccgcgaagccggcgttcttgtaca	Protospacer
 ***** ***** ***********  *   .

14. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 10, identity: 0.677

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgccggccgcattgccggcgttgccaactc	Protospacer
***********.* *********   ...  

15. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 10, identity: 0.677

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ttgccggccaggtagccggcgttcaccaacc	Protospacer
..*******. **************  .   

16. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 10, identity: 0.677

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgccggccgcattgccggcgttgccaactc	Protospacer
***********.* *********   ...  

17. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 10, identity: 0.677

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgccggccgcattgccggcgttgccaactc	Protospacer
***********.* *********   ...  

18. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.677

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgccggccgcattgccggcgttgccaactc	Protospacer
***********.* *********   ...  

19. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 10, identity: 0.677

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgccggccgcattgccggcgttgccaactc	Protospacer
***********.* *********   ...  

20. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP034542 (Brevibacillus sp. SCSIO 07484 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
acgctggccgcgaagccggcgttccgcaacc	Protospacer
 ***.******* *********** . .   

21. spacer 3.4|2680839|31|NZ_CP021395|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 10, identity: 0.677

ccgccggccgcgtagccggcgttcaaggtgg	CRISPR spacer
ccgccggccgcattgccggcgttgccaactc	Protospacer
***********.* *********   ...  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13229 12 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_2 50719 : 54574 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_3 59631 : 68205 8 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_4 71809 : 76176 5 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_5 79490 : 83526 4 Halovirus(33.33%) NA NA
DBSCAN-SWA_6 86983 : 88951 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_7 100318 : 104117 3 Brevibacillus_phage(33.33%) NA NA
DBSCAN-SWA_8 107774 : 108521 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_9 112037 : 117800 6 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_10 126801 : 128291 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_11 136700 : 139529 4 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_12 144944 : 145883 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_13 176586 : 183165 6 uncultured_Mediterranean_phage(75.0%) tRNA NA
DBSCAN-SWA_14 187834 : 188857 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_15 204555 : 206342 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_16 219127 : 224112 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_17 231644 : 234159 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_18 237892 : 238735 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_19 254353 : 255040 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_20 260545 : 263869 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_21 272751 : 275835 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_22 280049 : 281081 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_23 303667 : 304048 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_24 312687 : 315291 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_25 320509 : 321013 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_26 343482 : 344001 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_27 355194 : 360026 5 Cedratvirus(25.0%) NA NA
DBSCAN-SWA_28 374867 : 376538 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_29 383025 : 387517 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_30 407362 : 409027 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_31 422066 : 422969 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_32 430784 : 439459 5 Salmonella_phage(33.33%) NA NA
DBSCAN-SWA_33 443812 : 445270 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_34 448522 : 450109 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_35 461961 : 462783 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_36 466194 : 466743 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_37 470481 : 473076 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_38 478309 : 479152 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 492742 : 493864 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_40 499946 : 500732 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_41 517325 : 518342 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_42 526864 : 528520 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_43 555149 : 557397 2 Escherichia_coli_O157_typing_phage(50.0%) integrase attL 551765:551782|attR 557597:557614
DBSCAN-SWA_44 563561 : 566273 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_45 585145 : 586861 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_46 601979 : 602978 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_47 611578 : 619441 8 Bacillus_virus(66.67%) tRNA NA
DBSCAN-SWA_48 624300 : 626276 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_49 629707 : 633066 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_50 638904 : 648394 8 Paramecium_bursaria_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_51 652548 : 658554 3 Acanthamoeba_polyphaga_mimivirus(33.33%) NA NA
DBSCAN-SWA_52 700295 : 701735 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_53 706681 : 712311 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_54 719275 : 720865 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_55 723963 : 729174 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_56 733169 : 734930 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_57 738221 : 743693 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_58 750530 : 751859 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_59 757979 : 758741 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_60 765152 : 766313 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_61 771264 : 772212 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_62 782611 : 784554 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_63 788783 : 790382 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_64 810173 : 812739 3 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_65 816865 : 824319 7 Brazilian_cedratvirus(33.33%) NA NA
DBSCAN-SWA_66 839458 : 843554 4 Micromonas_sp._RCC1109_virus(66.67%) NA NA
DBSCAN-SWA_67 850211 : 852182 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_68 857097 : 858153 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_69 875314 : 878806 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_70 888081 : 890044 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_71 893772 : 898091 6 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_72 903833 : 905286 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_73 912018 : 912789 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 918146 : 918984 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_75 924024 : 926103 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_76 949141 : 964866 5 uncultured_Mediterranean_phage(75.0%) integrase attL 938888:938903|attR 970178:970193
DBSCAN-SWA_77 968433 : 969366 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_78 983574 : 984921 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_79 987954 : 989340 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_80 994308 : 999741 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_81 1004239 : 1005699 2 Equid_gammaherpesvirus(50.0%) NA NA
DBSCAN-SWA_82 1015318 : 1016971 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_83 1022257 : 1025131 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_84 1031292 : 1033074 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_85 1041253 : 1041817 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_86 1049084 : 1051160 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_87 1055553 : 1059228 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_88 1072199 : 1073653 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_89 1077890 : 1078934 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_90 1089792 : 1090518 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_91 1115204 : 1117695 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_92 1142439 : 1144296 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_93 1149806 : 1150772 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_94 1154690 : 1155713 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_95 1160847 : 1164326 4 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_96 1169705 : 1172423 4 Sphingobium_phage(33.33%) NA NA
DBSCAN-SWA_97 1180272 : 1186494 4 Oenococcus_phage(33.33%) NA NA
DBSCAN-SWA_98 1191276 : 1192500 1 Shahe_endorna-like_virus(100.0%) NA NA
DBSCAN-SWA_99 1204626 : 1205613 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_100 1214773 : 1217365 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_101 1227914 : 1235012 5 Leptospira_phage(66.67%) NA NA
DBSCAN-SWA_102 1240253 : 1242663 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_103 1261347 : 1262424 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_104 1266255 : 1270307 4 Pandoravirus(25.0%) NA NA
DBSCAN-SWA_105 1282045 : 1283179 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_106 1289209 : 1290193 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_107 1294714 : 1296166 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_108 1299191 : 1299449 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_109 1332558 : 1334193 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_110 1338176 : 1345124 9 Bacillus_virus(20.0%) tRNA NA
DBSCAN-SWA_111 1351790 : 1355407 4 Thermus_phage(50.0%) NA NA
DBSCAN-SWA_112 1366367 : 1372659 5 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_113 1383112 : 1384303 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_114 1389139 : 1396378 5 Feline_herpesvirus(25.0%) tRNA NA
DBSCAN-SWA_115 1405629 : 1407051 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_116 1413800 : 1419579 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_117 1425069 : 1425819 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_118 1429269 : 1430604 1 Erwinia_phage(100.0%) protease NA
DBSCAN-SWA_119 1434762 : 1439182 5 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_120 1444558 : 1448008 4 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_121 1454606 : 1460607 5 Catovirus(33.33%) holin,tRNA NA
DBSCAN-SWA_122 1468170 : 1469664 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_123 1479068 : 1480142 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_124 1486412 : 1493333 5 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_125 1496584 : 1502730 4 Moumouvirus(50.0%) NA NA
DBSCAN-SWA_126 1505991 : 1507872 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_127 1515220 : 1525725 7 Staphylococcus_phage(20.0%) NA NA
DBSCAN-SWA_128 1528917 : 1530000 1 Ostreococcus_mediterraneus_virus(100.0%) NA NA
DBSCAN-SWA_129 1554369 : 1555188 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_130 1561382 : 1562114 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_131 1569741 : 1576261 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_132 1581631 : 1598269 12 Vibrio_phage(16.67%) NA NA
DBSCAN-SWA_133 1601907 : 1602114 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_134 1631149 : 1633161 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_135 1639162 : 1645719 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_136 1654788 : 1657050 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_137 1665022 : 1666552 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_138 1670999 : 1672181 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_139 1675661 : 1677488 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_140 1681467 : 1686039 3 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_141 1697220 : 1702394 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_142 1719640 : 1722664 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_143 1736063 : 1743297 6 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_144 1747171 : 1748548 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_145 1754022 : 1754865 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_146 1760706 : 1762656 2 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_147 1772892 : 1777454 6 Pithovirus(50.0%) NA NA
DBSCAN-SWA_148 1786124 : 1794276 7 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_149 1797745 : 1799347 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_150 1806687 : 1817164 7 Saudi_moumouvirus(25.0%) NA NA
DBSCAN-SWA_151 1837308 : 1838809 2 Indivirus(100.0%) NA NA
DBSCAN-SWA_152 1846532 : 1847949 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_153 1869427 : 1872242 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_154 1882678 : 1883464 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_155 1895851 : 1897282 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_156 1904600 : 1906529 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_157 1911406 : 1916596 5 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_158 1923214 : 1924165 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_159 1928359 : 1929853 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_160 1942343 : 1947527 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_161 1966074 : 1966596 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_162 1979835 : 1980618 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_163 1997855 : 2002232 6 Caulobacter_phage(25.0%) NA NA
DBSCAN-SWA_164 2006649 : 2009327 4 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_165 2015381 : 2019391 3 Organic_Lake_phycodnavirus(66.67%) NA NA
DBSCAN-SWA_166 2033807 : 2035007 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_167 2040834 : 2042853 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_168 2050924 : 2051644 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_169 2058558 : 2074496 12 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_170 2089311 : 2094434 5 Pithovirus(33.33%) NA NA
DBSCAN-SWA_171 2114351 : 2115311 1 Barns_Ness_breadcrumb_sponge_sobemo-like_virus(100.0%) NA NA
DBSCAN-SWA_172 2123418 : 2124902 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_173 2128145 : 2128958 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_174 2162612 : 2170947 6 Pseudomonas_phage(75.0%) NA NA
DBSCAN-SWA_175 2181337 : 2182788 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_176 2186708 : 2188265 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_177 2204624 : 2215510 11 Lake_Baikal_phage(20.0%) tRNA NA
DBSCAN-SWA_178 2224891 : 2227776 2 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_179 2243253 : 2244915 1 IC4_retrovirus(100.0%) NA NA
DBSCAN-SWA_180 2254420 : 2254762 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_181 2260869 : 2273595 9 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_182 2277005 : 2281803 5 Shigella_phage(50.0%) NA NA
DBSCAN-SWA_183 2286209 : 2288324 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_184 2296790 : 2298521 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_185 2328503 : 2330312 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_186 2350188 : 2351169 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_187 2364267 : 2365968 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_188 2371464 : 2372553 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_189 2380511 : 2382734 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_190 2402342 : 2406567 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_191 2420471 : 2421557 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_192 2425066 : 2426944 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_193 2435800 : 2436550 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_194 2458237 : 2459380 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_195 2464531 : 2465065 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_196 2484316 : 2502572 9 uncultured_Mediterranean_phage(20.0%) tRNA NA
DBSCAN-SWA_197 2511414 : 2516327 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_198 2520925 : 2524071 2 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_199 2530412 : 2537312 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_200 2545328 : 2547731 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_201 2552908 : 2553415 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_202 2567522 : 2568311 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_203 2583228 : 2591999 5 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_204 2619360 : 2623471 5 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_205 2637323 : 2641432 3 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_206 2645454 : 2646917 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_207 2693198 : 2694203 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_208 2713120 : 2714734 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_209 2718026 : 2719847 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_210 2743522 : 2745823 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_211 2763785 : 2764469 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_212 2819325 : 2819868 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_213 2843963 : 2845706 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_214 2850098 : 2860185 8 Streptococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_215 2867416 : 2874958 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_216 2883034 : 2883706 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_217 2895609 : 2901088 4 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_218 2927203 : 2929825 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_219 2933082 : 2936703 2 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_220 2950496 : 2957936 5 Pithovirus(33.33%) NA NA
DBSCAN-SWA_221 2962390 : 2963155 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_222 2968801 : 2980862 10 Yersinia_phage(25.0%) NA NA
DBSCAN-SWA_223 3020410 : 3021145 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_224 3029647 : 3032512 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_225 3037990 : 3038668 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_226 3042441 : 3044277 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_227 3051697 : 3053178 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_228 3057414 : 3058590 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_229 3062814 : 3064128 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_230 3076297 : 3077077 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_231 3082629 : 3092928 11 Trichoplusia_ni_ascovirus(16.67%) protease NA
DBSCAN-SWA_232 3095990 : 3097505 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_233 3104303 : 3110949 5 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_234 3120014 : 3121901 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_235 3127428 : 3138210 10 Acinetobacter_phage(20.0%) NA NA
DBSCAN-SWA_236 3148419 : 3150198 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_237 3153660 : 3154737 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_238 3161598 : 3162282 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_239 3176584 : 3178012 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_240 3185530 : 3187576 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_241 3204783 : 3213259 4 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_242 3217491 : 3221956 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_243 3233834 : 3239832 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_244 3246752 : 3252250 6 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_245 3261540 : 3265570 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_246 3273079 : 3273625 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_247 3280397 : 3281486 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_248 3286265 : 3288969 3 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_249 3292531 : 3296810 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_250 3308300 : 3309428 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_251 3319591 : 3328043 3 Catovirus(33.33%) NA NA
DBSCAN-SWA_252 3335865 : 3340746 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_253 3350039 : 3351059 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_254 3354295 : 3354946 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_255 3368796 : 3370311 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_256 3376714 : 3381051 4 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_257 3384973 : 3386518 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_258 3398467 : 3401480 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_259 3410475 : 3415716 4 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_260 3421281 : 3425018 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_261 3428507 : 3429581 1 Edwardsiella_phage(100.0%) NA NA
DBSCAN-SWA_262 3440214 : 3445361 5 Burkholderia_virus(50.0%) tRNA NA
DBSCAN-SWA_263 3452597 : 3453755 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_264 3463499 : 3464783 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_265 3467866 : 3473086 4 Lactococcus_phage(33.33%) NA NA
DBSCAN-SWA_266 3476537 : 3486054 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_267 3505511 : 3506870 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_268 3510468 : 3511834 3 Synechococcus_phage(33.33%) protease NA
DBSCAN-SWA_269 3519329 : 3521639 1 Agrobacterium_phage(100.0%) protease NA
DBSCAN-SWA_270 3532745 : 3537581 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_271 3541465 : 3552733 13 Bodo_saltans_virus(20.0%) tRNA NA
DBSCAN-SWA_272 3558186 : 3564149 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_273 3571048 : 3571510 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_274 3593341 : 3599306 5 Bacillus_virus(50.0%) protease NA
DBSCAN-SWA_275 3603557 : 3605192 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_276 3615120 : 3616983 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_277 3632417 : 3633272 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_278 3640560 : 3646775 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_279 3652370 : 3661856 9 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_280 3675810 : 3676785 1 Sulfitobacter_phage(100.0%) NA NA
DBSCAN-SWA_281 3679849 : 3687725 5 uncultured_Caudovirales_phage(75.0%) NA NA
DBSCAN-SWA_282 3711681 : 3713202 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_283 3721949 : 3722708 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_284 3732968 : 3741400 9 Emiliania_huxleyi_virus(25.0%) NA NA
DBSCAN-SWA_285 3748619 : 3749243 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_286 3754282 : 3755047 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_287 3762500 : 3763097 1 Agrobacterium_phage(100.0%) protease NA
DBSCAN-SWA_288 3767083 : 3767590 1 Canarypox_virus(100.0%) NA NA
DBSCAN-SWA_289 3770901 : 3774402 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_290 3781191 : 3781884 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_291 3785311 : 3788041 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_292 3793178 : 3797764 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_293 3801128 : 3803372 1 Acidianus_spindle-shaped_virus(100.0%) NA NA
DBSCAN-SWA_294 3808722 : 3809706 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_295 3822252 : 3824207 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_296 3860435 : 3861176 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_297 3872322 : 3873234 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_298 3885181 : 3886831 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_299 3902597 : 3906170 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_300 3923097 : 3924168 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_301 3947124 : 3948668 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_302 3955878 : 3957255 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_303 3991413 : 4007923 15 Niemeyer_virus(16.67%) NA NA
DBSCAN-SWA_304 4013013 : 4015716 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_305 4029483 : 4036261 7 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_306 4048345 : 4050004 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_307 4068494 : 4073180 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_308 4081935 : 4085357 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_309 4093495 : 4094957 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_310 4099537 : 4099753 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_311 4107631 : 4108384 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_312 4113906 : 4114671 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_313 4124623 : 4126171 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_314 4130596 : 4134259 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_315 4144782 : 4146480 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_316 4160161 : 4161631 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_317 4165355 : 4165886 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_318 4170327 : 4171416 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_319 4181830 : 4183168 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_320 4187922 : 4190512 3 Pithovirus(50.0%) NA NA
DBSCAN-SWA_321 4193861 : 4195698 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_322 4201442 : 4202402 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_323 4210292 : 4211069 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_324 4216052 : 4224398 4 Hokovirus(33.33%) NA NA
DBSCAN-SWA_325 4229800 : 4231462 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_326 4241921 : 4247382 6 Clostridium_phage(25.0%) NA NA
DBSCAN-SWA_327 4265177 : 4290986 19 uncultured_Mediterranean_phage(22.22%) NA NA
DBSCAN-SWA_328 4295798 : 4308935 14 Moraxella_phage(28.57%) tRNA NA
DBSCAN-SWA_329 4327541 : 4328336 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_330 4333433 : 4334372 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_331 4337500 : 4338268 1 Turkeypox_virus(100.0%) NA NA
DBSCAN-SWA_332 4342596 : 4343604 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_333 4357342 : 4362504 4 Rhodococcus_phage(50.0%) NA NA
DBSCAN-SWA_334 4368077 : 4379145 13 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_335 4399231 : 4400038 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_336 4457626 : 4458238 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_337 4471561 : 4474038 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_338 4478945 : 4480956 2 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_339 4493455 : 4496603 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_340 4503440 : 4504439 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_341 4513079 : 4517129 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_342 4528111 : 4539051 10 Catovirus(40.0%) tRNA NA
DBSCAN-SWA_343 4543002 : 4543815 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_344 4546907 : 4550049 4 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_345 4556272 : 4565157 9 Lake_Baikal_phage(28.57%) protease NA
DBSCAN-SWA_346 4575116 : 4579505 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_347 4582889 : 4589206 5 Synechococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_348 4593869 : 4596268 3 Xanthomonas_phage(50.0%) NA NA
DBSCAN-SWA_349 4602828 : 4609022 6 Hokovirus(33.33%) tRNA NA
DBSCAN-SWA_350 4615194 : 4616850 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_351 4631582 : 4632641 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_352 4637901 : 4639374 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_353 4654071 : 4656411 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_354 4660734 : 4661427 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_355 4664770 : 4666905 3 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_356 4671568 : 4674310 3 Pseudomonas_phage(66.67%) NA NA
DBSCAN-SWA_357 4680216 : 4688643 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_358 4693217 : 4694132 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_359 4743782 : 4745441 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_360 4750851 : 4751895 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_361 4763693 : 4765025 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_362 4769227 : 4774179 5 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_363 4787690 : 4791689 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_364 4801012 : 4802077 1 uncultured_Caudovirales_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage