Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP019724 Bacteroides uniformis strain NBRC 113350 1 crisprs cas3,PrimPol,DEDDh,DinG,PD-DExK 0 1 6 2
NZ_AP019727 Bacteroides uniformis strain NBRC 113350 plasmid pBUN3, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP019726 Bacteroides uniformis strain NBRC 113350 plasmid pBUN2, complete sequence 0 crisprs RT 0 0 0 1
NZ_AP019728 Bacteroides uniformis strain NBRC 113350 plasmid pBUN4, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP019725 Bacteroides uniformis strain NBRC 113350 plasmid pBUN1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_AP019724
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP019724_1 981840-981971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP019724_1 1.1|981889|34|NZ_AP019724|CRISPRCasFinder 981889-981922 34 KX015771 Salmonella phage phSE-5, complete genome 47936-47969 10 0.706
NZ_AP019724_1 1.1|981889|34|NZ_AP019724|CRISPRCasFinder 981889-981922 34 MH729819 Citrobacter phage Sazh, complete genome 30972-31005 10 0.706
NZ_AP019724_1 1.1|981889|34|NZ_AP019724|CRISPRCasFinder 981889-981922 34 KX015770 Salmonella phage phSE-2, complete genome 25755-25788 10 0.706

1. spacer 1.1|981889|34|NZ_AP019724|CRISPRCasFinder matches to KX015771 (Salmonella phage phSE-5, complete genome) position: , mismatch: 10, identity: 0.706

ctgttattctccatttgcagaagtgtagaagtag	CRISPR spacer
tcgttattctccatttgaagaactgttaacacaa	Protospacer
..*************** **** *** .* ..*.

2. spacer 1.1|981889|34|NZ_AP019724|CRISPRCasFinder matches to MH729819 (Citrobacter phage Sazh, complete genome) position: , mismatch: 10, identity: 0.706

ctgttattctccatttgcagaagtgtagaagtag	CRISPR spacer
tcgttattctccatttgaagaactgttaacacaa	Protospacer
..*************** **** *** .* ..*.

3. spacer 1.1|981889|34|NZ_AP019724|CRISPRCasFinder matches to KX015770 (Salmonella phage phSE-2, complete genome) position: , mismatch: 10, identity: 0.706

ctgttattctccatttgcagaagtgtagaagtag	CRISPR spacer
tcgttattctccatttgaagaactgttaacacaa	Protospacer
..*************** **** *** .* ..*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 974509 : 1006619 30 unidentified_phage(40.0%) integrase,transposase,tRNA attL 966925:966984|attR 998814:998891
DBSCAN-SWA_2 1500034 : 1538961 25 Nonlabens_phage(50.0%) integrase,transposase attL 1529158:1529171|attR 1539214:1539227
DBSCAN-SWA_3 1653141 : 1703850 56 Streptococcus_phage(44.44%) integrase,transposase attL 1644541:1644555|attR 1659253:1659267
DBSCAN-SWA_4 2839288 : 2876987 46 Burkholderia_virus(22.22%) protease,capsid,head,tail,transposase,tRNA,portal,terminase NA
DBSCAN-SWA_5 2909668 : 2966418 47 unidentified_phage(20.0%) integrase,transposase,protease attL 2958640:2958659|attR 2966303:2966322
DBSCAN-SWA_6 4170457 : 4178752 6 Paenibacillus_phage(16.67%) integrase attL 4169129:4169142|attR 4183276:4183289
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AP019724.1|WP_057317067.1|3364557_3364980_-|PcfK-like-protein 3364557_3364980_- 140 aa aa 40 NA NA No NA
NZ_AP019724.1|WP_008654998.1|4330900_4331326_-|hypothetical-protein 4330900_4331326_- 141 aa aa 40 NA NA No NA
2. NZ_AP019726
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AP019726.1|WP_005868911.1|105101_105512_+|hypothetical-protein 105101_105512_+ 136 aa aa 40 NA NA No NA