Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP019736 Alistipes dispar strain 5CPEGH6 1 crisprs RT,DEDDh,cas3,WYL 0 1 1 1

Results visualization

1. NZ_AP019736
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP019736_1 2239924-2240007 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP019736_1 1.1|2239951|30|NZ_AP019736|CRISPRCasFinder 2239951-2239980 30 NZ_CP054608 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed9, complete sequence 126-155 8 0.733
NZ_AP019736_1 1.1|2239951|30|NZ_AP019736|CRISPRCasFinder 2239951-2239980 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 515615-515644 9 0.7

1. spacer 1.1|2239951|30|NZ_AP019736|CRISPRCasFinder matches to NZ_CP054608 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed9, complete sequence) position: , mismatch: 8, identity: 0.733

cgggatttccgaggcgggggcctatttcga	CRISPR spacer
cgggatttacgaggcggggggctgccgctg	Protospacer
******** *********** **... * .

2. spacer 1.1|2239951|30|NZ_AP019736|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7

cgggatttccgaggcgggggcctatttcga	CRISPR spacer
ggggatttccggggcgggggccgccacggc	Protospacer
 **********.**********  . . * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 156317 : 165318 8 unidentified_phage(71.43%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AP019736.1|WP_032135197.1|336417_336837_+|PcfK-like-protein 336417_336837_+ 139 aa aa 40 NA NA No NA