Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041193 Weissella cibaria strain CBA3612 chromosome, complete genome 2 crisprs csa3,csn2,cas2,cas1,cas9,cas3,DEDDh,csa5gr11 0 2 4 0
NZ_CP041194 Weissella cibaria strain CBA3612 plasmid pCBA3612-01, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP041196 Weissella cibaria strain CBA3612 plasmid pCBA3612-03, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041195 Weissella cibaria strain CBA3612 plasmid pCBA3612-02, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP041193
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041193_1 395796-396031 TypeII NA
3 spacers
csa3,csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041193_2 1661634-1661741 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041193_1 1.3|395966|28|NZ_CP041193|CRT 395966-395993 28 NC_006509 Geobacillus kaustophilus HTA426 plasmid pHTA426, complete sequence 10844-10871 6 0.786
NZ_CP041193_1 1.3|395966|28|NZ_CP041193|CRT 395966-395993 28 NC_010420 Geobacillus stearothermophilus plasmid pGS18, strain 18 9842-9869 6 0.786
NZ_CP041193_1 1.8|395968|28|NZ_CP041193|PILER-CR 395968-395995 28 NC_006509 Geobacillus kaustophilus HTA426 plasmid pHTA426, complete sequence 10844-10871 6 0.786
NZ_CP041193_1 1.8|395968|28|NZ_CP041193|PILER-CR 395968-395995 28 NC_010420 Geobacillus stearothermophilus plasmid pGS18, strain 18 9842-9869 6 0.786
NZ_CP041193_1 1.3|395966|28|NZ_CP041193|CRT 395966-395993 28 KC430106 Bacillus phage BPS10C, complete genome 157877-157904 7 0.75
NZ_CP041193_1 1.3|395966|28|NZ_CP041193|CRT 395966-395993 28 JN654439 Bacillus phage BPS13, complete genome 156571-156598 7 0.75
NZ_CP041193_1 1.3|395966|28|NZ_CP041193|CRT 395966-395993 28 NC_031034 Bacillus phage SalinJah, complete genome 32852-32879 7 0.75
NZ_CP041193_1 1.8|395968|28|NZ_CP041193|PILER-CR 395968-395995 28 KC430106 Bacillus phage BPS10C, complete genome 157877-157904 7 0.75
NZ_CP041193_1 1.8|395968|28|NZ_CP041193|PILER-CR 395968-395995 28 JN654439 Bacillus phage BPS13, complete genome 156571-156598 7 0.75
NZ_CP041193_1 1.8|395968|28|NZ_CP041193|PILER-CR 395968-395995 28 NC_031034 Bacillus phage SalinJah, complete genome 32852-32879 7 0.75

1. spacer 1.3|395966|28|NZ_CP041193|CRT matches to NC_006509 (Geobacillus kaustophilus HTA426 plasmid pHTA426, complete sequence) position: , mismatch: 6, identity: 0.786

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
tttcaagaactttcaaccaatcatcttc	Protospacer
  ******** *****.********  *

2. spacer 1.3|395966|28|NZ_CP041193|CRT matches to NC_010420 (Geobacillus stearothermophilus plasmid pGS18, strain 18) position: , mismatch: 6, identity: 0.786

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
tttcaagaactttcaaccaatcatcttc	Protospacer
  ******** *****.********  *

3. spacer 1.8|395968|28|NZ_CP041193|PILER-CR matches to NC_006509 (Geobacillus kaustophilus HTA426 plasmid pHTA426, complete sequence) position: , mismatch: 6, identity: 0.786

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
tttcaagaactttcaaccaatcatcttc	Protospacer
  ******** *****.********  *

4. spacer 1.8|395968|28|NZ_CP041193|PILER-CR matches to NC_010420 (Geobacillus stearothermophilus plasmid pGS18, strain 18) position: , mismatch: 6, identity: 0.786

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
tttcaagaactttcaaccaatcatcttc	Protospacer
  ******** *****.********  *

5. spacer 1.3|395966|28|NZ_CP041193|CRT matches to KC430106 (Bacillus phage BPS10C, complete genome) position: , mismatch: 7, identity: 0.75

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
aatcaagaacgttcaaacaataaaaggg	Protospacer
**************** **** *  .. 

6. spacer 1.3|395966|28|NZ_CP041193|CRT matches to JN654439 (Bacillus phage BPS13, complete genome) position: , mismatch: 7, identity: 0.75

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
aatcaagaacgttcaaacaataaaaggg	Protospacer
**************** **** *  .. 

7. spacer 1.3|395966|28|NZ_CP041193|CRT matches to NC_031034 (Bacillus phage SalinJah, complete genome) position: , mismatch: 7, identity: 0.75

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
aatcaagaacgttcaaacaataaaaggg	Protospacer
**************** **** *  .. 

8. spacer 1.8|395968|28|NZ_CP041193|PILER-CR matches to KC430106 (Bacillus phage BPS10C, complete genome) position: , mismatch: 7, identity: 0.75

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
aatcaagaacgttcaaacaataaaaggg	Protospacer
**************** **** *  .. 

9. spacer 1.8|395968|28|NZ_CP041193|PILER-CR matches to JN654439 (Bacillus phage BPS13, complete genome) position: , mismatch: 7, identity: 0.75

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
aatcaagaacgttcaaacaataaaaggg	Protospacer
**************** **** *  .. 

10. spacer 1.8|395968|28|NZ_CP041193|PILER-CR matches to NC_031034 (Bacillus phage SalinJah, complete genome) position: , mismatch: 7, identity: 0.75

aatcaagaacgttcaatcaatcatcaac	CRISPR spacer
aatcaagaacgttcaaacaataaaaggg	Protospacer
**************** **** *  .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 580927 : 631929 63 Enterococcus_phage(39.29%) capsid,protease,terminase,tRNA,tail,portal,head,integrase attL 595287:595306|attR 631986:632005
DBSCAN-SWA_2 722374 : 731016 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 1856444 : 1919428 59 Bacillus_phage(18.75%) protease,transposase NA
DBSCAN-SWA_4 2172280 : 2286003 107 Lactococcus_phage(37.14%) capsid,protease,terminase,tRNA,portal,head,integrase,transposase attL 2228735:2228751|attR 2267197:2267213
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage