Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041054 Enterobacter hormaechei strain C126 chromosome, complete genome 1 crisprs DEDDh 0 1 4 0
NZ_CP041057 Enterobacter hormaechei strain C126 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041059 Enterobacter hormaechei strain C126 plasmid unnamed5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041056 Enterobacter hormaechei strain C126 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041060 Enterobacter hormaechei strain C126 plasmid unnamed6 0 crisprs NA 0 0 0 0
NZ_CP041052 Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP041053 Enterobacter hormaechei strain C126 plasmid pEnC126OXA181, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041055 Enterobacter hormaechei strain C126 plasmid unnamed1 0 crisprs NA 0 0 0 0
NZ_CP041058 Enterobacter hormaechei strain C126 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP041054
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041054_1 897559-897641 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041054_1 1.1|897587|27|NZ_CP041054|CRISPRCasFinder 897587-897613 27 NZ_LR134256 Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence 1565-1591 4 0.852

1. spacer 1.1|897587|27|NZ_CP041054|CRISPRCasFinder matches to NZ_LR134256 (Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.852

ctccacctccacaggcattgatataac	CRISPR spacer
ctccacctccgcaggcattggtactac	Protospacer
**********.*********.**. **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 683 : 4502 6 Enterobacteria_phage(50.0%) tail NA
DBSCAN-SWA_2 861071 : 866271 6 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_3 869278 : 876611 12 Escherichia_phage(71.43%) NA NA
DBSCAN-SWA_4 4457424 : 4462300 10 Colwellia_phage(22.22%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP041052
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3804 : 59775 54 Escherichia_phage(27.78%) transposase,integrase attL 57507:57522|attR 62417:62432
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage