Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040882 Sutterella faecalis strain KGMB03119 chromosome, complete genome 1 crisprs cas12j,WYL,RT,c2c9_V-U4,DEDDh,cas14j,DinG 0 1 7 0

Results visualization

1. NZ_CP040882
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040882_1 791385-791594 Orphan I-B,III-A,III-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040882_1 1.2|791473|33|NZ_CP040882|CRISPRCasFinder 791473-791505 33 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 231224-231256 10 0.697

1. spacer 1.2|791473|33|NZ_CP040882|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

atggcatgactgaaggcagccgccccttcgaca	CRISPR spacer
acggcagggctgaaggcagccgccccgggcggg	Protospacer
*.**** *.*****************    . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 64813 : 121063 47 Pandoravirus(20.0%) transposase NA
DBSCAN-SWA_2 232411 : 301538 49 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_3 704027 : 745417 33 Escherichia_phage(16.67%) transposase NA
DBSCAN-SWA_4 1349594 : 1496177 111 Agrobacterium_phage(11.11%) tRNA,transposase,protease NA
DBSCAN-SWA_5 1757504 : 1768258 9 Escherichia_phage(16.67%) transposase NA
DBSCAN-SWA_6 2477977 : 2534884 46 Bacillus_phage(12.5%) tRNA,transposase NA
DBSCAN-SWA_7 2794664 : 2898506 104 Bordetella_phage(12.12%) terminase,transposase,portal,head,tail,holin,plate,capsid,tRNA,integrase,protease attL 2826187:2826205|attR 2913355:2913373
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage