Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031206 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_H, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031199 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_A, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP031204 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_F, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031207 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_I, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031205 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_G, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031203 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_E, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031202 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_D, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031201 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_C, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP031200 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP031198 Lactobacillus brevis strain UCCLBBS449 chromosome, complete genome 1 crisprs cas3,csa3,DEDDh,DinG 0 2 12 0

Results visualization

1. NZ_CP031201
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031201_1 6959-7058 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NZ_CP014927 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-3, complete sequence 35572-35603 0 1.0
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NZ_CP014928 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence 27239-27270 0 1.0
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NZ_CP014932 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-8, complete sequence 38856-38887 0 1.0
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NZ_CP014918 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-3, complete sequence 5597-5628 0 1.0
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NZ_CP017263 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.22, complete sequence 23046-23077 0 1.0
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NC_022114 Lactobacillus paracasei subsp. paracasei 8700:2 plasmid 1, complete sequence 633-664 0 1.0
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NZ_CP031201 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_C, complete sequence 6993-7024 0 1.0
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NZ_CP019324 Lactobacillus allii strain WiKim39 plasmid pWIKIM01, complete sequence 27911-27942 0 1.0
NZ_CP031201_1 1.1|6993|32|NZ_CP031201|CRISPRCasFinder 6993-7024 32 NZ_CP018330 Lactobacillus plantarum subsp. plantarum strain TS12 plasmid pLP12-6, complete sequence 18421-18452 2 0.938

1. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NZ_CP014927 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgtccttttcaacggtgtcatgctga	Protospacer
********************************

2. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NZ_CP014928 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgtccttttcaacggtgtcatgctga	Protospacer
********************************

3. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NZ_CP014932 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-8, complete sequence) position: , mismatch: 0, identity: 1.0

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgtccttttcaacggtgtcatgctga	Protospacer
********************************

4. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NZ_CP014918 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgtccttttcaacggtgtcatgctga	Protospacer
********************************

5. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NZ_CP017263 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.22, complete sequence) position: , mismatch: 0, identity: 1.0

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgtccttttcaacggtgtcatgctga	Protospacer
********************************

6. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NC_022114 (Lactobacillus paracasei subsp. paracasei 8700:2 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgtccttttcaacggtgtcatgctga	Protospacer
********************************

7. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NZ_CP031201 (Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_C, complete sequence) position: , mismatch: 0, identity: 1.0

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgtccttttcaacggtgtcatgctga	Protospacer
********************************

8. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NZ_CP019324 (Lactobacillus allii strain WiKim39 plasmid pWIKIM01, complete sequence) position: , mismatch: 0, identity: 1.0

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgtccttttcaacggtgtcatgctga	Protospacer
********************************

9. spacer 1.1|6993|32|NZ_CP031201|CRISPRCasFinder matches to NZ_CP018330 (Lactobacillus plantarum subsp. plantarum strain TS12 plasmid pLP12-6, complete sequence) position: , mismatch: 2, identity: 0.938

tttgagcgtccttttcaacggtgtcatgctga	CRISPR spacer
tttgagcgcccttctcaacggtgtcatgctga	Protospacer
********.****.******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP031199
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17972 : 64533 42 unidentified_phage(20.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP031200
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031200_1 39587-39690 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NC_017017 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence 5388-5415 0 1.0
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP014928 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence 6825-6852 0 1.0
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NC_017468 Lactobacillus helveticus H10 plasmid pH10, complete sequence 15845-15872 0 1.0
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 5238-5265 0 1.0
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP033891 Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence 3331-3358 0 1.0
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP031200 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence 39625-39652 0 1.0
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP014920 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence 12633-12660 0 1.0
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NC_008498 Lactobacillus brevis ATCC 367 plasmid 1, complete sequence 8763-8790 1 0.964
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP014874 Lactobacillus backii strain TMW 1.1989 plasmid pL11989-1, complete sequence 6855-6882 1 0.964
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NC_006529 Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence 4743-4770 1 0.964
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP014900 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence 28836-28863 1 0.964
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP027191 Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence 29360-29387 1 0.964
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP027195 Lactobacillus sp. CBA3606 plasmid pCBA3606-1, complete sequence 30410-30437 1 0.964
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NC_015421 Lactobacillus buchneri NRRL B-30929 plasmid pLBUC03, complete sequence 1006-1033 1 0.964
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP014913 Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence 22509-22536 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP019033 Lactobacillus fermentum strain SNUV175 plasmid pSNU175-4, complete sequence 21084-21111 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP017368 Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-5, complete sequence 5771-5798 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP017265 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence 26505-26532 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP017960 Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence 6892-6919 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP017960 Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence 20911-20938 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP017358 Lactobacillus plantarum strain TMW 1.25 plasmid pL125-4, complete sequence 4831-4858 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP019982 Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence 10406-10433 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP019982 Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence 86925-86952 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP014934 Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence 5934-5961 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP014937 Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence 5935-5962 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 MK994179 Lactobacillus plantarum strain PC518 plasmid plp75TA, complete sequence 4886-4913 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP011537 Lactobacillus fermentum 3872 plasmid pLF3872, complete sequence 7182-7209 2 0.929
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_AP014682 Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence 516-543 4 0.857
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 NZ_CP017093 Streptococcus suis strain ISU2812 plasmid pISU2812, complete sequence 160-187 5 0.821
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 KX785321 Streptococcus suis strain 6936 plasmid unnamed1, complete sequence 2250-2277 5 0.821
NZ_CP031200_1 1.1|39625|28|NZ_CP031200|CRISPRCasFinder 39625-39652 28 MN034684 Leviviridae sp. isolate H1_Rhizo_27_scaffold_801 RNA-dependent RNA polymerase (H1Rhizo27801_000001), hypothetical protein (H1Rhizo27801_000002), and hypothetical protein (H1Rhizo27801_000003) genes, complete cds 2055-2082 6 0.786

1. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NC_017017 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence) position: , mismatch: 0, identity: 1.0

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcgtcaacgaactttcgcgaa	Protospacer
****************************

2. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP014928 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence) position: , mismatch: 0, identity: 1.0

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcgtcaacgaactttcgcgaa	Protospacer
****************************

3. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NC_017468 (Lactobacillus helveticus H10 plasmid pH10, complete sequence) position: , mismatch: 0, identity: 1.0

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcgtcaacgaactttcgcgaa	Protospacer
****************************

4. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 0, identity: 1.0

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcgtcaacgaactttcgcgaa	Protospacer
****************************

5. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP033891 (Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence) position: , mismatch: 0, identity: 1.0

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcgtcaacgaactttcgcgaa	Protospacer
****************************

6. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP031200 (Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence) position: , mismatch: 0, identity: 1.0

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcgtcaacgaactttcgcgaa	Protospacer
****************************

7. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP014920 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence) position: , mismatch: 0, identity: 1.0

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcgtcaacgaactttcgcgaa	Protospacer
****************************

8. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NC_008498 (Lactobacillus brevis ATCC 367 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.964

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
tggggtgtcgtcaacgaactttcgcgaa	Protospacer
.***************************

9. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP014874 (Lactobacillus backii strain TMW 1.1989 plasmid pL11989-1, complete sequence) position: , mismatch: 1, identity: 0.964

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgttgtcaacgaactttcgcgaa	Protospacer
********.*******************

10. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NC_006529 (Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence) position: , mismatch: 1, identity: 0.964

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcgtcaacggactttcgcgaa	Protospacer
****************.***********

11. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP014900 (Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence) position: , mismatch: 1, identity: 0.964

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgttgtcaacgaactttcgcgaa	Protospacer
********.*******************

12. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP027191 (Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence) position: , mismatch: 1, identity: 0.964

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgttgtcaacgaactttcgcgaa	Protospacer
********.*******************

13. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP027195 (Lactobacillus sp. CBA3606 plasmid pCBA3606-1, complete sequence) position: , mismatch: 1, identity: 0.964

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgttgtcaacgaactttcgcgaa	Protospacer
********.*******************

14. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NC_015421 (Lactobacillus buchneri NRRL B-30929 plasmid pLBUC03, complete sequence) position: , mismatch: 1, identity: 0.964

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cgggttgtcgtcaacgaactttcgcgaa	Protospacer
**** ***********************

15. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP014913 (Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

16. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP019033 (Lactobacillus fermentum strain SNUV175 plasmid pSNU175-4, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggagtgtcgtcaacggactttcgcgaa	Protospacer
***.************.***********

17. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP017368 (Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-5, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

18. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP017265 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

19. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP017960 (Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

20. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP017960 (Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

21. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP017358 (Lactobacillus plantarum strain TMW 1.25 plasmid pL125-4, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

22. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP019982 (Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggagtgttgtcaacgaactttcgcgaa	Protospacer
***.****.*******************

23. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP019982 (Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggagtgttgtcaacgaactttcgcgaa	Protospacer
***.****.*******************

24. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP014934 (Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

25. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP014937 (Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

26. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to MK994179 (Lactobacillus plantarum strain PC518 plasmid plp75TA, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggggtgtcatcaacggactttcgcgaa	Protospacer
*********.******.***********

27. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP011537 (Lactobacillus fermentum 3872 plasmid pLF3872, complete sequence) position: , mismatch: 2, identity: 0.929

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cggagtgtcgtcaacggactttcgcgaa	Protospacer
***.************.***********

28. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_AP014682 (Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence) position: , mismatch: 4, identity: 0.857

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
aggggtgtcgtcaacgaacttatgcgga	Protospacer
 ******************** .***.*

29. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to NZ_CP017093 (Streptococcus suis strain ISU2812 plasmid pISU2812, complete sequence) position: , mismatch: 5, identity: 0.821

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cagcttatcgtcaacgaactttcgcgac	Protospacer
*.*  *.******************** 

30. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to KX785321 (Streptococcus suis strain 6936 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
cagcttatcgtcaacgaactttcgcgac	Protospacer
*.*  *.******************** 

31. spacer 1.1|39625|28|NZ_CP031200|CRISPRCasFinder matches to MN034684 (Leviviridae sp. isolate H1_Rhizo_27_scaffold_801 RNA-dependent RNA polymerase (H1Rhizo27801_000001), hypothetical protein (H1Rhizo27801_000002), and hypothetical protein (H1Rhizo27801_000003) genes, complete cds) position: , mismatch: 6, identity: 0.786

cggggtgtcgtcaacgaactttcgcgaa	CRISPR spacer
gctggtgtcgtcaacgaacattcgctac	Protospacer
   **************** ***** * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP031198
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031198_1 2529867-2530199 Orphan I-E,II-B
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031198_1 1.1|2529895|33|NZ_CP031198|CRISPRCasFinder,CRT 2529895-2529927 33 KY979109 Salmonella phage SHP1, complete genome 32802-32834 8 0.758
NZ_CP031198_1 1.1|2529895|33|NZ_CP031198|CRISPRCasFinder,CRT 2529895-2529927 33 NC_019500 Enterobacteria phage Bp7, complete genome 22258-22290 8 0.758
NZ_CP031198_1 1.2|2529956|33|NZ_CP031198|CRISPRCasFinder,CRT,PILER-CR 2529956-2529988 33 MG592538 Vibrio phage 1.171.O._10N.261.52.F12, partial genome 46866-46898 8 0.758

1. spacer 1.1|2529895|33|NZ_CP031198|CRISPRCasFinder,CRT matches to KY979109 (Salmonella phage SHP1, complete genome) position: , mismatch: 8, identity: 0.758

gcttaaaatcaagcagtcgttgggctacgtcaa	CRISPR spacer
tcttaacatcaagcagtcgtttggcattatcac	Protospacer
 ***** ************** ***  ..*** 

2. spacer 1.1|2529895|33|NZ_CP031198|CRISPRCasFinder,CRT matches to NC_019500 (Enterobacteria phage Bp7, complete genome) position: , mismatch: 8, identity: 0.758

gcttaaaatcaagcagtcgttgggctacgtcaa	CRISPR spacer
tcttaacatcaagcagtcgtttggcattatcac	Protospacer
 ***** ************** ***  ..*** 

3. spacer 1.2|2529956|33|NZ_CP031198|CRISPRCasFinder,CRT,PILER-CR matches to MG592538 (Vibrio phage 1.171.O._10N.261.52.F12, partial genome) position: , mismatch: 8, identity: 0.758

caactgacacccgttgagccacttcccatgcaa	CRISPR spacer
gccccgacacccgttgagccgctacccatggta	Protospacer
   *.***************.** ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 30561 : 81368 46 Bacillus_phage(18.75%) transposase,protease NA
DBSCAN-SWA_2 774216 : 782870 7 Streptococcus_phage(33.33%) transposase NA
DBSCAN-SWA_3 825335 : 886203 57 Lactococcus_phage(17.65%) transposase,integrase attL 861495:861513|attR 871207:871225
DBSCAN-SWA_4 984797 : 1042802 54 unidentified_phage(25.0%) transposase,integrase,protease attL 1019477:1019492|attR 1043901:1043916
DBSCAN-SWA_5 1214874 : 1261304 43 Streptococcus_phage(15.38%) transposase,tRNA,protease NA
DBSCAN-SWA_6 1324235 : 1369335 41 Bacillus_virus(17.65%) transposase,tRNA,protease NA
DBSCAN-SWA_7 1513481 : 1569300 59 Megavirus(14.29%) transposase,tRNA,protease NA
DBSCAN-SWA_8 1578515 : 1642357 54 Staphylococcus_prophage(13.33%) transposase,tRNA,protease NA
DBSCAN-SWA_9 1646383 : 1712094 79 Lactobacillus_phage(83.33%) plate,integrase,terminase,transposase,tail,protease attL 1660702:1660718|attR 1709080:1709096
DBSCAN-SWA_10 2003695 : 2062608 59 Staphylococcus_phage(21.43%) transposase,protease NA
DBSCAN-SWA_11 2139333 : 2186686 43 Staphylococcus_phage(27.27%) transposase,protease NA
DBSCAN-SWA_12 2383617 : 2418898 34 Staphylococcus_prophage(66.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage