Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031187 Lactobacillus brevis strain SA-C12 plasmid pSAC12_B, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031186 Lactobacillus brevis strain SA-C12 plasmid pSAC12_A, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031185 Lactobacillus brevis strain SA-C12 chromosome, complete genome 2 crisprs cas3,csa3,DEDDh,DinG 0 3 8 0

Results visualization

1. NZ_CP031185
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031185_1 110685-110831 Orphan I-E,II-B
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031185_2 2398891-2399162 Orphan I-E,II-B
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031185_2 2.1|2398919|33|NZ_CP031185|CRISPRCasFinder,CRT 2398919-2398951 33 MN830254 Lactobacillus phage JNU_P2, complete genome 17234-17266 1 0.97
NZ_CP031185_2 2.1|2398919|33|NZ_CP031185|CRISPRCasFinder,CRT 2398919-2398951 33 MN830255 Lactobacillus phage JNU_P4, complete genome 3757-3789 1 0.97
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 NZ_CP014920 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence 5729-5761 1 0.97
NZ_CP031185_2 2.2|2398980|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2398980-2399012 33 NZ_CP014917 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-2, complete sequence 23424-23456 2 0.939
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 MK496698 Capybara microvirus Cap1_SP_87, complete genome 2934-2966 7 0.788
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 NC_017296 Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence 62340-62372 7 0.788
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 NC_015686 Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence 62340-62372 7 0.788
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 NC_001988 Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence 62340-62372 7 0.788
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 NZ_CP047434 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6 89325-89357 10 0.697
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 NZ_CP047434 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6 98643-98675 10 0.697
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 NZ_LR214978 Mycoplasma cynos strain NCTC10142 plasmid 5 6-38 10 0.697
NZ_CP031185_2 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR 2399102-2399134 33 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 771862-771894 10 0.697

1. spacer 2.1|2398919|33|NZ_CP031185|CRISPRCasFinder,CRT matches to MN830254 (Lactobacillus phage JNU_P2, complete genome) position: , mismatch: 1, identity: 0.97

tgacaaccaaaaaatatacgactttaacttctg	CRISPR spacer
tggcaaccaaaaaatatacgactttaacttctg	Protospacer
**.******************************

2. spacer 2.1|2398919|33|NZ_CP031185|CRISPRCasFinder,CRT matches to MN830255 (Lactobacillus phage JNU_P4, complete genome) position: , mismatch: 1, identity: 0.97

tgacaaccaaaaaatatacgactttaacttctg	CRISPR spacer
tggcaaccaaaaaatatacgactttaacttctg	Protospacer
**.******************************

3. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014920 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence) position: , mismatch: 1, identity: 0.97

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gatgaataagaaaagaaaacaagataatacgca	Protospacer
**********************.**********

4. spacer 2.2|2398980|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014917 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-2, complete sequence) position: , mismatch: 2, identity: 0.939

cggaaagtttaaatctattaaagacgcacaata	CRISPR spacer
cggaaagttcaaatctattaaggacgcacaata	Protospacer
*********.***********.***********

5. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to MK496698 (Capybara microvirus Cap1_SP_87, complete genome) position: , mismatch: 7, identity: 0.788

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gatgaataataaaagaaaataaaataaactaaa	Protospacer
********* *********.*******  .. *

6. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NC_017296 (Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence) position: , mismatch: 7, identity: 0.788

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gaataataagaaaagaaaaacaaataatataaa	Protospacer
**  ***************  ********.. *

7. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NC_015686 (Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence) position: , mismatch: 7, identity: 0.788

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gaataataagaaaagaaaaacaaataatataaa	Protospacer
**  ***************  ********.. *

8. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NC_001988 (Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence) position: , mismatch: 7, identity: 0.788

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gaataataagaaaagaaaaacaaataatataaa	Protospacer
**  ***************  ********.. *

9. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 10, identity: 0.697

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gtattataagaaaagaaaaaagaataataaaag	Protospacer
*    ************** *.******* . .

10. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 10, identity: 0.697

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
gtattataagaaaagaaaaaagaataataaaag	Protospacer
*    ************** *.******* . .

11. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214978 (Mycoplasma cynos strain NCTC10142 plasmid 5) position: , mismatch: 10, identity: 0.697

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
atagaataagaaaagaaaacaacaaaaacatta	Protospacer
.  ******************* * **    .*

12. spacer 2.4|2399102|33|NZ_CP031185|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 10, identity: 0.697

gatgaataagaaaagaaaacaaaataatacgca	CRISPR spacer
atagaataagaaaagaaaacaacaaaaacatta	Protospacer
.  ******************* * **    .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 674864 : 739450 59 Streptococcus_phage(21.74%) tRNA,holin,transposase,protease NA
DBSCAN-SWA_2 807239 : 815593 15 Lactobacillus_phage(44.44%) NA NA
DBSCAN-SWA_3 820368 : 845928 30 Lactobacillus_phage(100.0%) plate,tail,terminase NA
DBSCAN-SWA_4 1261739 : 1272417 10 Staphylococcus_phage(37.5%) tRNA,transposase NA
DBSCAN-SWA_5 1354880 : 1439668 98 Lactobacillus_phage(52.63%) capsid,tRNA,tail,terminase,head,integrase,portal,protease attL 1367260:1367279|attR 1447130:1447149
DBSCAN-SWA_6 1444242 : 1457321 19 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_7 1568812 : 1639787 57 Staphylococcus_phage(16.67%) tRNA,transposase,protease NA
DBSCAN-SWA_8 1708136 : 1718194 8 Streptococcus_phage(71.43%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage