Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031171 Lactobacillus brevis strain UCCLBBS124 plasmid pUCCLBBS124_B, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031173 Lactobacillus brevis strain UCCLBBS124 plasmid pUCCLBBS124_D, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031169 Lactobacillus brevis strain UCCLBBS124 chromosome, complete genome 1 crisprs cas3,csa3,DEDDh,DinG,WYL 0 1 5 0
NZ_CP031170 Lactobacillus brevis strain UCCLBBS124 plasmid pUCCLBBS124_A, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031172 Lactobacillus brevis strain UCCLBBS124 plasmid pUCCLBBS124_C, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP031169
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031169_1 1173083-1173415 Orphan I-E,II-B
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 MN693505 Marine virus AFVG_25M41, complete genome 16522-16554 9 0.727
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 MN693370 Marine virus AFVG_25M236, complete genome 17276-17308 9 0.727
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 MN693072 Marine virus AFVG_25M5, complete genome 21558-21590 9 0.727
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 MN693265 Marine virus AFVG_25M542, complete genome 20682-20714 9 0.727
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 MN693192 Marine virus AFVG_25M42, complete genome 21027-21059 9 0.727
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 MH823906 Citrobacter phage Maroon, complete genome 37650-37682 10 0.697
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 KX431560 Cronobacter phage vB_CsaM_leN, complete genome 37922-37954 10 0.697
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 NC_048646 Cronobacter phage vB_CsaM_leE, complete genome 37922-37954 10 0.697
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 KT381880 Citrobacter phage Margaery, complete genome 38095-38127 10 0.697
NZ_CP031169_1 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT 1173294-1173326 33 NC_048645 Cronobacter phage vB_CsaM_leB, complete genome 38458-38490 10 0.697

1. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to MN693505 (Marine virus AFVG_25M41, complete genome) position: , mismatch: 9, identity: 0.727

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
gagatagataaagtaaaagctgctgaaataaaa	Protospacer
  .**.******** *************  .*.

2. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to MN693370 (Marine virus AFVG_25M236, complete genome) position: , mismatch: 9, identity: 0.727

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
gagatagataaagtaaaagctgctgaaataaaa	Protospacer
  .**.******** *************  .*.

3. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to MN693072 (Marine virus AFVG_25M5, complete genome) position: , mismatch: 9, identity: 0.727

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
gagatagataaagtaaaagctgctgaaataaaa	Protospacer
  .**.******** *************  .*.

4. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to MN693265 (Marine virus AFVG_25M542, complete genome) position: , mismatch: 9, identity: 0.727

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
gagatagataaagtaaaagctgctgaaataaaa	Protospacer
  .**.******** *************  .*.

5. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to MN693192 (Marine virus AFVG_25M42, complete genome) position: , mismatch: 9, identity: 0.727

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
gagatagataaagtaaaagctgctgaaataaaa	Protospacer
  .**.******** *************  .*.

6. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to MH823906 (Citrobacter phage Maroon, complete genome) position: , mismatch: 10, identity: 0.697

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
ggagtgcataaagttaaagctgctgaaactcca	Protospacer
  *.** *******.************* .  .

7. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to KX431560 (Cronobacter phage vB_CsaM_leN, complete genome) position: , mismatch: 10, identity: 0.697

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
ggagtgcataaagttaaagctgctgaaactcca	Protospacer
  *.** *******.************* .  .

8. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to NC_048646 (Cronobacter phage vB_CsaM_leE, complete genome) position: , mismatch: 10, identity: 0.697

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
ggagtgcataaagttaaagctgctgaaactcca	Protospacer
  *.** *******.************* .  .

9. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to KT381880 (Citrobacter phage Margaery, complete genome) position: , mismatch: 10, identity: 0.697

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
ggagtgcataaagttaaagctgctgaaactcca	Protospacer
  *.** *******.************* .  .

10. spacer 1.7|1173294|33|NZ_CP031169|CRISPRCasFinder,CRT matches to NC_048645 (Cronobacter phage vB_CsaM_leB, complete genome) position: , mismatch: 10, identity: 0.697

ttaatggataaagtcaaagctgctgaaagcgag	CRISPR spacer
ggagtgcataaagttaaagctgctgaaactcca	Protospacer
  *.** *******.************* .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1242776 : 1294774 55 Staphylococcus_phage(28.57%) protease,transposase NA
DBSCAN-SWA_2 1303324 : 1367680 53 Staphylococcus_phage(22.73%) protease,transposase,tRNA NA
DBSCAN-SWA_3 1483027 : 1490966 12 Lactobacillus_phage(42.86%) terminase,portal NA
DBSCAN-SWA_4 1494483 : 1501726 10 Lactobacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 2190189 : 2237070 43 Staphylococcus_phage(30.0%) transposase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage