Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 1 crisprs csa3 7 46 0 0
NZ_CP035291 Staphylococcus haemolyticus strain ATCC 29970 chromosome, complete genome 1 crisprs WYL,csa3,DEDDh,cas3,DinG 0 0 8 0
NZ_CP035293 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed2, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP035292
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035292_1 16089-20146 Orphan NA
46 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292.1 16067-16094 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 53623-53644 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 55267-55288 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 55321-55342 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 57157-57178 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 57211-57232 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 59317-59338 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 59371-59392 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 61207-61228 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 61261-61282 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 63589-63610 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035291.1 63643-63664 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292.1 16067-16100 0 1.0
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 53623-53644 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 55267-55288 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 55321-55342 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 57157-57178 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 57211-57232 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 59317-59338 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 59371-59392 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 61207-61228 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 61261-61282 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 63589-63610 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035291.1 63643-63664 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 53731-53752 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 53899-53920 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 54745-54766 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 55591-55612 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 57481-57502 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 57949-57970 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 58795-58816 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 59641-59662 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 61531-61552 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 61999-62020 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035291.1 63025-63046 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292.1 16067-16088 2 0.909
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292.1 16085-16136 2 0.962
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292.1 16061-16142 22 0.732

1. spacer 1.27|18671|28|NZ_CP035292|CRT matches to position: 16067-16094, mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

2. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 53623-53644, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

3. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 55267-55288, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

4. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 55321-55342, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

5. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 57157-57178, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

6. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 57211-57232, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

7. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 59317-59338, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

8. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 59371-59392, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

9. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 61207-61228, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

10. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 61261-61282, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

11. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 63589-63610, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

12. spacer 1.39|19535|22|NZ_CP035292|CRT matches to position: 63643-63664, mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

13. spacer 1.46|20081|34|NZ_CP035292|CRT matches to position: 16067-16100, mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

14. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 53623-53644, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

15. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 55267-55288, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

16. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 55321-55342, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

17. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 57157-57178, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

18. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 57211-57232, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

19. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 59317-59338, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

20. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 59371-59392, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

21. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 61207-61228, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

22. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 61261-61282, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

23. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 63589-63610, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

24. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 63643-63664, mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

25. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 53731-53752, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

26. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 53899-53920, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

27. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 54745-54766, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

28. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 55591-55612, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

29. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 57481-57502, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

30. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 57949-57970, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

31. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 58795-58816, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

32. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 59641-59662, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

33. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 61531-61552, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

34. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 61999-62020, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

35. spacer 1.22|18359|22|NZ_CP035292|CRT matches to position: 63025-63046, mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ctcagattcagacagcgatagc	Protospacer
*** **.***************

36. spacer 1.26|18617|22|NZ_CP035292|CRT matches to position: 16067-16088, mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagtgattca	Protospacer
******.********.******

37. spacer 1.30|18839|52|NZ_CP035292|CRT matches to position: 16085-16136, mismatch: 2, identity: 0.962

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattcagacagcgatagcgactcagactct	Protospacer
*************************** **************.*********

38. spacer 1.11|17351|82|NZ_CP035292|CRT matches to position: 16061-16142, mismatch: 22, identity: 0.732

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP035292_1 1.14|17669|46|NZ_CP035292|CRT 17669-17714 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17297-17342 0 1.0
NZ_CP035292_1 1.14|17669|46|NZ_CP035292|CRT 17669-17714 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17669-17714 0 1.0
NZ_CP035292_1 1.14|17669|46|NZ_CP035292|CRT 17669-17714 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19151-19196 0 1.0
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17855-17894 0 1.0
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19337-19376 0 1.0
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18125-18164 0 1.0
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19607-19646 0 1.0
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18197-18236 0 1.0
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19679-19718 0 1.0
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16601-16658 0 1.0
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16913-16970 0 1.0
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18269-18326 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16685-16706 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16877-16898 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16979-17000 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17879-17900 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17951-17972 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18335-18356 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18359-18380 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19079-19100 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19361-19382 0 1.0
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19433-19454 0 1.0
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17279-17324 0 1.0
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17651-17696 0 1.0
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18413-18458 0 1.0
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19133-19178 0 1.0
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16733-16772 0 1.0
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17729-17768 0 1.0
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18491-18530 0 1.0
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19211-19250 0 1.0
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18563-18584 0 1.0
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17453-17474 0 1.0
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18617-18638 0 1.0
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18767-18788 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16067-16094 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16199-16226 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16331-16358 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17357-17384 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17507-17534 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17573-17600 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18089-18116 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18233-18260 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18671-18698 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18821-18848 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19571-19598 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19715-19742 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19775-19802 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19895-19922 0 1.0
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20081-20108 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16127-16148 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16259-16280 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16391-16412 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17069-17090 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17327-17348 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17417-17438 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17699-17720 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18731-18752 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19181-19202 0 1.0
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20009-20030 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17471-17492 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17903-17924 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18131-18152 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18383-18404 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18785-18806 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19013-19034 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19103-19124 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19385-19406 0 1.0
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19613-19634 0 1.0
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17591-17642 0 1.0
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18839-18890 0 1.0
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18923-18968 0 1.0
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19001-19046 0 1.0
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17879-17924 0 1.0
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18359-18404 0 1.0
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19079-19124 0 1.0
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19361-19406 0 1.0
NZ_CP035292_1 1.34|19157|46|NZ_CP035292|CRT 19157-19202 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17303-17348 0 1.0
NZ_CP035292_1 1.34|19157|46|NZ_CP035292|CRT 19157-19202 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17675-17720 0 1.0
NZ_CP035292_1 1.34|19157|46|NZ_CP035292|CRT 19157-19202 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19157-19202 0 1.0
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16757-16808 0 1.0
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17753-17804 0 1.0
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19235-19286 0 1.0
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17837-17870 0 1.0
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19319-19352 0 1.0
NZ_CP035292_1 1.37|19385|40|NZ_CP035292|CRT 19385-19424 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17903-17942 0 1.0
NZ_CP035292_1 1.37|19385|40|NZ_CP035292|CRT 19385-19424 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19385-19424 0 1.0
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17975-18020 0 1.0
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18437-18482 0 1.0
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19457-19502 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16571-16592 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16823-16844 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17249-17270 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17285-17306 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17657-17678 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18053-18074 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18419-18440 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18995-19016 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19139-19160 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19535-19556 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19817-19838 0 1.0
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19865-19886 0 1.0
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18107-18146 0 1.0
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19589-19628 0 1.0
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18179-18218 0 1.0
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19661-19700 0 1.0
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19835-19880 0 1.0
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19913-19952 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16067-16100 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16199-16232 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16331-16364 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17357-17390 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17507-17540 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17573-17606 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18089-18122 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18233-18266 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18671-18704 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18821-18854 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19571-19604 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19715-19748 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19775-19808 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19895-19928 0 1.0
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20081-20114 0 1.0
NZ_CP035292_1 1.14|17669|46|NZ_CP035292|CRT 17669-17714 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17969-18014 1 0.978
NZ_CP035292_1 1.14|17669|46|NZ_CP035292|CRT 17669-17714 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18431-18476 1 0.978
NZ_CP035292_1 1.14|17669|46|NZ_CP035292|CRT 17669-17714 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19451-19496 1 0.978
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16685-16724 1 0.975
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18335-18374 1 0.975
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16703-16742 1 0.975
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18941-18980 1 0.975
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16103-16124 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16133-16154 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16235-16256 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16265-16286 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16367-16388 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16397-16418 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16643-16664 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16709-16730 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16817-16838 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16853-16874 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16955-16976 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17045-17066 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17075-17096 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17279-17300 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17333-17354 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17393-17414 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17423-17444 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17543-17564 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17651-17672 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17705-17726 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17813-17834 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17855-17876 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18311-18332 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18413-18434 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18707-18728 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18737-18758 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18899-18920 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18923-18944 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18947-18968 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19055-19076 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19133-19154 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19187-19208 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19295-19316 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19337-19358 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19811-19832 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19859-19880 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19985-20006 1 0.955
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20015-20036 1 0.955
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17951-17996 1 0.978
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19433-19478 1 0.978
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17501-17540 1 0.975
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17567-17606 1 0.975
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18083-18122 1 0.975
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18227-18266 1 0.975
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18815-18854 1 0.975
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19565-19604 1 0.975
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19709-19748 1 0.975
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19889-19928 1 0.975
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20075-20114 1 0.975
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17339-17360 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18653-18674 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20021-20042 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20105-20126 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16163-16184 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16181-16202 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16295-16316 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16313-16334 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16427-16448 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16553-16574 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16571-16592 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16823-16844 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17105-17126 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17231-17252 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17249-17270 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17285-17306 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17657-17678 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18035-18056 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18053-18074 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18419-18440 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18545-18566 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18977-18998 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18995-19016 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19139-19160 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19517-19538 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19535-19556 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19757-19778 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19817-19838 1 0.955
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19865-19886 1 0.955
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16739-16766 1 0.964
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17735-17762 1 0.964
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18497-18524 1 0.964
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19217-19244 1 0.964
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16445-16472 1 0.964
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17123-17150 1 0.964
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17003-17024 1 0.955
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17999-18020 1 0.955
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18461-18482 1 0.955
NZ_CP035292_1 1.28|18731|22|NZ_CP035292|CRT 18731-18752 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19481-19502 1 0.955
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19931-19952 1 0.955
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16757-16808 1 0.981
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17753-17804 1 0.981
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19235-19286 1 0.981
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19793-19844 1 0.981
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16685-16730 1 0.978
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16853-16898 1 0.978
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16955-17000 1 0.978
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18311-18356 1 0.978
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19055-19100 1 0.978
NZ_CP035292_1 1.34|19157|46|NZ_CP035292|CRT 19157-19202 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17975-18020 1 0.978
NZ_CP035292_1 1.34|19157|46|NZ_CP035292|CRT 19157-19202 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18437-18482 1 0.978
NZ_CP035292_1 1.34|19157|46|NZ_CP035292|CRT 19157-19202 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19457-19502 1 0.978
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17591-17642 1 0.981
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18839-18890 1 0.981
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16667-16700 1 0.971
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18575-18608 1 0.971
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21283-21316 1 0.971
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21301-21334 1 0.971
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21355-21388 1 0.971
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15760-15793 1 0.971
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15904-15937 1 0.971
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9985-10018 1 0.971
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17303-17348 1 0.978
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17675-17720 1 0.978
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19157-19202 1 0.978
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16883-16904 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17885-17906 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17957-17978 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18113-18134 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18365-18386 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19085-19106 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19367-19388 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19439-19460 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19595-19616 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16109-16130 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16241-16262 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16373-16394 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16781-16802 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17051-17072 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17399-17420 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17453-17474 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17615-17636 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17777-17798 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18617-18638 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18713-18734 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18767-18788 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18863-18884 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19259-19280 1 0.955
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19991-20012 1 0.955
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16445-16478 1 0.971
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16739-16772 1 0.971
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17123-17156 1 0.971
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17735-17768 1 0.971
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18497-18530 1 0.971
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19217-19250 1 0.971
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16643-16682 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16853-16892 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16955-16994 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17813-17852 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18311-18350 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18389-18428 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18923-18962 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19055-19094 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19109-19148 2 0.95
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19295-19334 2 0.95
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17897-17936 2 0.95
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19007-19046 2 0.95
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19379-19418 2 0.95
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17537-17576 2 0.95
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16517-16556 2 0.95
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17195-17234 2 0.95
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18107-18128 2 0.909
NZ_CP035292_1 1.22|18359|22|NZ_CP035292|CRT 18359-18380 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19589-19610 2 0.909
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 CP054891 Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence 162260-162281 2 0.909
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 CP054891 Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence 162266-162287 2 0.909
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 CP054891 Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence 162272-162293 2 0.909
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 NZ_CP026099 Shigella flexneri strain FDAARGOS_74 plasmid unnamed 69554-69575 2 0.909
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 NZ_CP026099 Shigella flexneri strain FDAARGOS_74 plasmid unnamed 69560-69581 2 0.909
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 NZ_CP026099 Shigella flexneri strain FDAARGOS_74 plasmid unnamed 69566-69587 2 0.909
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 MG592621 Vibrio phage 1.255.O._10N.286.45.F1, partial genome 156970-156991 2 0.909
NZ_CP035292_1 1.25|18563|22|NZ_CP035292|CRT 18563-18584 22 MG592609 Vibrio phage 1.244.A._10N.261.54.C3, partial genome 156970-156991 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16883-16904 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17885-17906 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17957-17978 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18113-18134 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18365-18386 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19085-19106 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19367-19388 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19439-19460 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19595-19616 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19643-19664 2 0.909
NZ_CP035292_1 1.26|18617|22|NZ_CP035292|CRT 18617-18638 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3214-3235 2 0.909
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18545-18572 2 0.929
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19643-19670 2 0.929
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16607-16634 2 0.929
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16919-16946 2 0.929
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17453-17480 2 0.929
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18275-18302 2 0.929
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18767-18794 2 0.929
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17003-17024 2 0.909
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17999-18020 2 0.909
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18461-18482 2 0.909
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19481-19502 2 0.909
NZ_CP035292_1 1.29|18785|22|NZ_CP035292|CRT 18785-18806 22 NZ_CP016746 Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence 27862-27883 2 0.909
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16085-16136 2 0.962
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16217-16268 2 0.962
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16349-16400 2 0.962
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17375-17426 2 0.962
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18689-18740 2 0.962
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18335-18380 2 0.957
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18899-18944 2 0.957
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17891-17936 2 0.957
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18119-18164 2 0.957
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19373-19418 2 0.957
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19601-19646 2 0.957
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19823-19868 2 0.957
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18107-18152 2 0.957
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19589-19634 2 0.957
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16979-17024 2 0.957
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17447-17492 2 0.957
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18761-18806 2 0.957
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17633-17684 2 0.962
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19793-19844 2 0.962
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16487-16520 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17009-17042 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17027-17060 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17165-17198 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21121-21154 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21139-21172 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21319-21352 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21337-21370 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15742-15775 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15922-15955 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15940-15973 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9679-9712 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9697-9730 2 0.941
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9841-9874 2 0.941
NZ_CP035292_1 1.37|19385|40|NZ_CP035292|CRT 19385-19424 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18131-18170 2 0.95
NZ_CP035292_1 1.37|19385|40|NZ_CP035292|CRT 19385-19424 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19613-19652 2 0.95
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16469-16490 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16649-16670 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16859-16880 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16961-16982 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16985-17006 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17147-17168 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17339-17360 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17819-17840 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18161-18182 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18317-18338 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18653-18674 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18905-18926 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18929-18950 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19061-19082 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19301-19322 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20021-20042 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20105-20126 2 0.909
NZ_CP035292_1 1.39|19535|22|NZ_CP035292|CRT 19535-19556 22 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 1047343-1047364 2 0.909
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17879-17918 2 0.95
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18359-18398 2 0.95
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19079-19118 2 0.95
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19361-19400 2 0.95
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17975-18014 2 0.95
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18437-18476 2 0.95
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19457-19496 2 0.95
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16607-16640 2 0.941
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16919-16952 2 0.941
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18275-18308 2 0.941
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16463-16502 3 0.925
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17141-17180 3 0.925
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18179-18218 3 0.925
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19661-19700 3 0.925
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17849-17888 3 0.925
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19331-19370 3 0.925
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18161-18188 3 0.893
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20021-20048 3 0.893
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20105-20132 3 0.893
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17633-17684 3 0.942
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16643-16688 3 0.935
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17813-17858 3 0.935
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19295-19340 3 0.935
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17525-17558 3 0.912
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155989-156022 3 0.912
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16979-17024 3 0.935
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16979-17018 3 0.925
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17975-18014 3 0.925
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18437-18476 3 0.925
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19457-19496 3 0.925
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17855-17894 3 0.925
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18155-18194 3 0.925
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18389-18428 3 0.925
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19109-19148 3 0.925
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19337-19376 3 0.925
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19643-19676 3 0.912
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20021-20054 3 0.912
NZ_CP035292_1 1.12|17465|64|NZ_CP035292|CRT 17465-17528 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17465-17528 4 0.938
NZ_CP035292_1 1.12|17465|64|NZ_CP035292|CRT 17465-17528 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18779-18842 4 0.938
NZ_CP035292_1 1.14|17669|46|NZ_CP035292|CRT 17669-17714 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18173-18218 4 0.913
NZ_CP035292_1 1.17|17927|64|NZ_CP035292|CRT 17927-17990 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17927-17990 4 0.938
NZ_CP035292_1 1.17|17927|64|NZ_CP035292|CRT 17927-17990 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19409-19472 4 0.938
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17999-18038 4 0.9
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18461-18500 4 0.9
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19481-19520 4 0.9
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18539-18578 4 0.9
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16061-16100 4 0.9
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16193-16232 4 0.9
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16325-16364 4 0.9
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17351-17390 4 0.9
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18665-18704 4 0.9
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19769-19808 4 0.9
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16553-16580 4 0.857
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17231-17258 4 0.857
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18035-18062 4 0.857
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18977-19004 4 0.857
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19517-19544 4 0.857
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18989-19034 4 0.913
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20099-20138 4 0.9
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17303-17342 4 0.9
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17675-17714 4 0.9
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19157-19196 4 0.9
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19076 4 0.913
NZ_CP035292_1 1.45|19985|64|NZ_CP035292|CRT 19985-20048 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19985-20048 4 0.938
NZ_CP035292_1 1.14|17669|46|NZ_CP035292|CRT 17669-17714 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19655-19700 5 0.891
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16979-17018 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16127-16166 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16259-16298 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16391-16430 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17069-17108 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17417-17456 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17699-17738 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18731-18770 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19181-19220 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18641-18680 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17471-17510 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18383-18422 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18785-18824 5 0.875
NZ_CP035292_1 1.20|18197|40|NZ_CP035292|CRT 18197-18236 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19103-19142 5 0.875
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16061-16118 5 0.914
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16193-16250 5 0.914
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16325-16382 5 0.914
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17351-17408 5 0.914
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18665-18722 5 0.914
NZ_CP035292_1 1.21|18269|58|NZ_CP035292|CRT 18269-18326 58 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19769-19826 5 0.914
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16439-16478 5 0.875
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17117-17156 5 0.875
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16163-16190 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16181-16208 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16295-16322 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16313-16340 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16427-16454 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17105-17132 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19757-19784 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16841-16868 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17267-17294 5 0.821
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19847-19874 5 0.821
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16799-16850 5 0.904
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18629-18662 5 0.853
NZ_CP035292_1 1.37|19385|40|NZ_CP035292|CRT 19385-19424 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16499-16538 5 0.875
NZ_CP035292_1 1.37|19385|40|NZ_CP035292|CRT 19385-19424 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17177-17216 5 0.875
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18989-19028 5 0.875
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18179-18218 5 0.875
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19661-19700 5 0.875
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18107-18146 5 0.875
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19589-19628 5 0.875
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17453-17486 5 0.853
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18545-18578 5 0.853
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18767-18800 5 0.853
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17975-18014 6 0.85
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18107-18146 6 0.85
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18437-18476 6 0.85
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19457-19496 6 0.85
NZ_CP035292_1 1.16|17855|40|NZ_CP035292|CRT 17855-17894 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19589-19628 6 0.85
NZ_CP035292_1 1.17|17927|64|NZ_CP035292|CRT 17927-17990 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18335-18398 6 0.906
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16589-16616 6 0.786
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16901-16928 6 0.786
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18071-18098 6 0.786
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18617-18644 6 0.786
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19025-19052 6 0.786
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19553-19580 6 0.786
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20063-20090 6 0.786
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16799-16850 6 0.885
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16463-16508 6 0.87
NZ_CP035292_1 1.31|18923|46|NZ_CP035292|CRT 18923-18968 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17141-17186 6 0.87
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18371-18416 6 0.87
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19091-19136 6 0.87
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19913-19946 6 0.824
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18185-18218 6 0.824
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19667-19700 6 0.824
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17951-17990 6 0.85
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18155-18194 6 0.85
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19433-19472 6 0.85
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17855-17894 6 0.85
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19337-19376 6 0.85
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20015-20054 6 0.85
NZ_CP035292_1 1.41|19661|40|NZ_CP035292|CRT 19661-19700 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16979-17018 6 0.85
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17021-17066 6 0.87
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19013-19058 6 0.87
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20105-20138 6 0.824
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21229-21262 6 0.824
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15850-15883 6 0.824
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9787-9820 6 0.824
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9931-9964 6 0.824
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16493-16532 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17171-17210 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21055-21094 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21361-21400 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15442-15481 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15550-15589 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15676-15715 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15766-15805 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9613-9652 7 0.825
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9991-10030 7 0.825
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16103-16148 7 0.848
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16235-16280 7 0.848
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16367-16412 7 0.848
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16979-17024 7 0.848
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17045-17090 7 0.848
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17393-17438 7 0.848
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18707-18752 7 0.848
NZ_CP035292_1 1.23|18413|46|NZ_CP035292|CRT 18413-18458 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19985-20030 7 0.848
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17339-17366 7 0.75
NZ_CP035292_1 1.27|18671|28|NZ_CP035292|CRT 18671-18698 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18653-18680 7 0.75
NZ_CP035292_1 1.30|18839|52|NZ_CP035292|CRT 18839-18890 52 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18593-18644 7 0.865
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17459-17504 7 0.848
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18773-18818 7 0.848
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19643-19676 7 0.794
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 10003-10036 7 0.794
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155683-155716 7 0.794
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18155-18200 7 0.848
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17279-17318 7 0.825
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17651-17690 7 0.825
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18413-18452 7 0.825
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19133-19172 7 0.825
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19637-19676 7 0.825
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20051-20096 7 0.848
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156601-156634 7 0.794
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157423-157456 7 0.794
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153853-153886 7 0.794
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154519-154552 7 0.794
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154789-154822 7 0.794
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155005-155038 7 0.794
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155239-155272 7 0.794
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1126-1159 7 0.794
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21307-21346 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21145-21184 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21163-21202 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21379-21418 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15910-15949 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15784-15823 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15964-16003 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9595-9634 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9703-9742 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9721-9760 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9847-9886 8 0.8
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9865-9904 8 0.8
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17987-18032 8 0.826
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18449-18494 8 0.826
NZ_CP035292_1 1.32|19001|46|NZ_CP035292|CRT 19001-19046 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19469-19514 8 0.826
NZ_CP035292_1 1.33|19079|46|NZ_CP035292|CRT 19079-19124 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20015-20060 8 0.826
NZ_CP035292_1 1.34|19157|46|NZ_CP035292|CRT 19157-19202 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18155-18200 8 0.826
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16067-16100 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16199-16232 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16331-16364 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17357-17390 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17507-17540 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17573-17606 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17933-17966 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18089-18122 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18233-18266 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18671-18704 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18821-18854 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19415-19448 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19571-19604 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19715-19748 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19775-19808 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19895-19928 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19967-20000 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20081-20114 8 0.765
NZ_CP035292_1 1.36|19319|34|NZ_CP035292|CRT 19319-19352 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21445-21478 8 0.765
NZ_CP035292_1 1.38|19457|46|NZ_CP035292|CRT 19457-19502 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19637-19682 8 0.826
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16829-16874 8 0.826
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17255-17300 8 0.826
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19619-19658 8 0.8
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21277-21316 8 0.8
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21043-21082 8 0.8
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15898-15937 8 0.8
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15538-15577 8 0.8
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15664-15703 8 0.8
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9979-10018 8 0.8
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9583-9622 8 0.8
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17837-17870 8 0.765
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19319-19352 8 0.765
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155185-155218 8 0.765
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155419-155452 8 0.765
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156127-156160 8 0.765
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3394-3427 8 0.765
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21289-21328 9 0.775
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21199-21238 9 0.775
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21415-21454 9 0.775
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15748-15787 9 0.775
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15604-15643 9 0.775
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15820-15859 9 0.775
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15946-15985 9 0.775
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9757-9796 9 0.775
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9901-9940 9 0.775
NZ_CP035292_1 1.24|18491|40|NZ_CP035292|CRT 18491-18530 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18611-18650 9 0.775
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18647-18686 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18575-18614 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21061-21100 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21169-21208 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21295-21334 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21349-21388 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21259-21298 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21115-21154 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21187-21226 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15448-15487 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15556-15595 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15682-15721 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15754-15793 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15790-15829 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15736-15775 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15880-15919 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15430-15469 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15808-15847 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9619-9658 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9727-9766 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9871-9910 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9601-9640 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9673-9712 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9745-9784 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9835-9874 9 0.775
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9889-9928 9 0.775
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16589-16622 9 0.735
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16901-16934 9 0.735
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18617-18650 9 0.735
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19025-19058 9 0.735
NZ_CP035292_1 1.6|16793|70|NZ_CP035292|CRT 16793-16862 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16793-16862 10 0.857
NZ_CP035292_1 1.7|16895|70|NZ_CP035292|CRT 16895-16964 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16583-16652 10 0.857
NZ_CP035292_1 1.7|16895|70|NZ_CP035292|CRT 16895-16964 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16895-16964 10 0.857
NZ_CP035292_1 1.18|18023|70|NZ_CP035292|CRT 18023-18092 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18023-18092 10 0.857
NZ_CP035292_1 1.18|18023|70|NZ_CP035292|CRT 18023-18092 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19505-19574 10 0.857
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21127-21166 10 0.75
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21325-21364 10 0.75
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21343-21382 10 0.75
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15730-15769 10 0.75
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15928-15967 10 0.75
NZ_CP035292_1 1.19|18125|40|NZ_CP035292|CRT 18125-18164 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9685-9724 10 0.75
NZ_CP035292_1 1.40|19589|40|NZ_CP035292|CRT 19589-19628 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17333-17372 10 0.75
NZ_CP035292_1 1.42|19733|70|NZ_CP035292|CRT 19733-19802 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19733-19802 10 0.857
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17009-17048 10 0.75
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21133-21172 10 0.75
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21313-21352 10 0.75
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21331-21370 10 0.75
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15916-15955 10 0.75
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15934-15973 10 0.75
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9691-9730 10 0.75
NZ_CP035292_1 1.44|19913|40|NZ_CP035292|CRT 19913-19952 40 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9817-9856 10 0.75
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155455-155488 10 0.706
NZ_CP035292_1 1.46|20081|34|NZ_CP035292|CRT 20081-20114 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156235-156268 10 0.706
NZ_CP035292_1 1.12|17465|64|NZ_CP035292|CRT 17465-17528 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16511-16574 11 0.828
NZ_CP035292_1 1.12|17465|64|NZ_CP035292|CRT 17465-17528 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17189-17252 11 0.828
NZ_CP035292_1 1.18|18023|70|NZ_CP035292|CRT 18023-18092 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16541-16610 11 0.843
NZ_CP035292_1 1.18|18023|70|NZ_CP035292|CRT 18023-18092 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17219-17288 11 0.843
NZ_CP035292_1 1.35|19235|52|NZ_CP035292|CRT 19235-19286 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154825-154876 11 0.788
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18059-18104 11 0.761
NZ_CP035292_1 1.43|19835|46|NZ_CP035292|CRT 19835-19880 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19541-19586 11 0.761
NZ_CP035292_1 1.6|16793|70|NZ_CP035292|CRT 16793-16862 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17627-17696 14 0.8
NZ_CP035292_1 1.6|16793|70|NZ_CP035292|CRT 16793-16862 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18875-18944 15 0.786
NZ_CP035292_1 1.7|16895|70|NZ_CP035292|CRT 16895-16964 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18251-18320 15 0.786
NZ_CP035292_1 1.17|17927|64|NZ_CP035292|CRT 17927-17990 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17255-17318 15 0.766
NZ_CP035292_1 1.6|16793|70|NZ_CP035292|CRT 16793-16862 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17789-17858 16 0.771
NZ_CP035292_1 1.6|16793|70|NZ_CP035292|CRT 16793-16862 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19271-19340 16 0.771
NZ_CP035292_1 1.10|17243|76|NZ_CP035292|CRT 17243-17318 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17243-17318 16 0.789
NZ_CP035292_1 1.13|17561|76|NZ_CP035292|CRT 17561-17636 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17561-17636 16 0.789
NZ_CP035292_1 1.15|17747|76|NZ_CP035292|CRT 17747-17822 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16751-16826 16 0.789
NZ_CP035292_1 1.15|17747|76|NZ_CP035292|CRT 17747-17822 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17747-17822 16 0.789
NZ_CP035292_1 1.15|17747|76|NZ_CP035292|CRT 17747-17822 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19229-19304 16 0.789
NZ_CP035292_1 1.17|17927|64|NZ_CP035292|CRT 17927-17990 64 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17627-17690 16 0.75
NZ_CP035292_1 1.6|16793|70|NZ_CP035292|CRT 16793-16862 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16751-16820 17 0.757
NZ_CP035292_1 1.6|16793|70|NZ_CP035292|CRT 16793-16862 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17747-17816 17 0.757
NZ_CP035292_1 1.6|16793|70|NZ_CP035292|CRT 16793-16862 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19229-19298 17 0.757
NZ_CP035292_1 1.13|17561|76|NZ_CP035292|CRT 17561-17636 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18809-18884 17 0.776
NZ_CP035292_1 1.13|17561|76|NZ_CP035292|CRT 17561-17636 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16727-16802 17 0.776
NZ_CP035292_1 1.13|17561|76|NZ_CP035292|CRT 17561-17636 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17723-17798 17 0.776
NZ_CP035292_1 1.13|17561|76|NZ_CP035292|CRT 17561-17636 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19205-19280 17 0.776
NZ_CP035292_1 1.15|17747|76|NZ_CP035292|CRT 17747-17822 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17585-17660 17 0.776
NZ_CP035292_1 1.15|17747|76|NZ_CP035292|CRT 17747-17822 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18833-18908 17 0.776
NZ_CP035292_1 1.7|16895|70|NZ_CP035292|CRT 16895-16964 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18797-18866 19 0.729
NZ_CP035292_1 1.15|17747|76|NZ_CP035292|CRT 17747-17822 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19787-19862 20 0.737
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16061-16142 22 0.732
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16193-16274 22 0.732
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16325-16406 22 0.732
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17351-17432 22 0.732
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18665-18746 22 0.732
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19769-19850 22 0.732
NZ_CP035292_1 1.42|19733|70|NZ_CP035292|CRT 19733-19802 70 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17315-17384 22 0.686
NZ_CP035292_1 1.13|17561|76|NZ_CP035292|CRT 17561-17636 76 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16055-16130 24 0.684
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17567-17648 26 0.683
NZ_CP035292_1 1.11|17351|82|NZ_CP035292|CRT 17351-17432 82 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18815-18896 26 0.683
NZ_CP035292_1 1.4|16541|88|NZ_CP035292|CRT 16541-16628 88 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16541-16628 28 0.682
NZ_CP035292_1 1.8|16997|88|NZ_CP035292|CRT 16997-17084 88 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16997-17084 28 0.682
NZ_CP035292_1 1.4|16541|88|NZ_CP035292|CRT 16541-16628 88 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18023-18110 29 0.67
NZ_CP035292_1 1.4|16541|88|NZ_CP035292|CRT 16541-16628 88 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19505-19592 29 0.67
NZ_CP035292_1 1.9|17117|94|NZ_CP035292|CRT 17117-17210 94 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16439-16532 34 0.638
NZ_CP035292_1 1.9|17117|94|NZ_CP035292|CRT 17117-17210 94 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17117-17210 34 0.638
NZ_CP035292_1 1.1|16121|100|NZ_CP035292|CRT 16121-16220 100 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16121-16220 40 0.6
NZ_CP035292_1 1.1|16121|100|NZ_CP035292|CRT 16121-16220 100 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16253-16352 40 0.6
NZ_CP035292_1 1.2|16253|100|NZ_CP035292|CRT 16253-16352 100 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16121-16220 40 0.6
NZ_CP035292_1 1.2|16253|100|NZ_CP035292|CRT 16253-16352 100 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16253-16352 40 0.6
NZ_CP035292_1 1.5|16661|100|NZ_CP035292|CRT 16661-16760 100 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16661-16760 40 0.6
NZ_CP035292_1 1.3|16385|124|NZ_CP035292|CRT 16385-16508 124 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16385-16508 64 0.484
NZ_CP035292_1 1.3|16385|124|NZ_CP035292|CRT 16385-16508 124 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17063-17186 64 0.484

1. spacer 1.14|17669|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgattcagactcagatagcgatagcgactcagactctgactca	CRISPR spacer
tagcgattcagactcagatagcgatagcgactcagactctgactca	Protospacer
**********************************************

2. spacer 1.14|17669|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgattcagactcagatagcgatagcgactcagactctgactca	CRISPR spacer
tagcgattcagactcagatagcgatagcgactcagactctgactca	Protospacer
**********************************************

3. spacer 1.14|17669|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgattcagactcagatagcgatagcgactcagactctgactca	CRISPR spacer
tagcgattcagactcagatagcgatagcgactcagactctgactca	Protospacer
**********************************************

4. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctcagactcagacagcgatagcgactctgactcagacagc	Protospacer
****************************************

5. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctcagactcagacagcgatagcgactctgactcagacagc	Protospacer
****************************************

6. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactcagactca	Protospacer
****************************************

7. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactcagactca	Protospacer
****************************************

8. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
tagcgactcagactcagacagcgacagcgactctgattca	Protospacer
****************************************

9. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
tagcgactcagactcagacagcgacagcgactctgattca	Protospacer
****************************************

10. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	Protospacer
**********************************************************

11. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	Protospacer
**********************************************************

12. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	Protospacer
**********************************************************

13. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

14. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

15. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

16. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

17. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

18. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

19. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

20. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

21. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

22. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgatagc	Protospacer
**********************

23. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgattcagactcagatagcgatagc	Protospacer
**********************************************

24. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgattcagactcagatagcgatagc	Protospacer
**********************************************

25. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgattcagactcagatagcgatagc	Protospacer
**********************************************

26. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgattcagactcagatagcgatagc	Protospacer
**********************************************

27. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactctgacagc	Protospacer
****************************************

28. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactctgacagc	Protospacer
****************************************

29. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactctgacagc	Protospacer
****************************************

30. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactctgacagc	Protospacer
****************************************

31. spacer 1.25|18563|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactctgactcagactca	CRISPR spacer
ttcagactctgactcagactca	Protospacer
**********************

32. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgacagcgattca	Protospacer
**********************

33. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgacagcgattca	Protospacer
**********************

34. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgacagcgattca	Protospacer
**********************

35. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

36. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

37. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

38. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

39. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

40. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

41. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

42. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

43. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

44. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

45. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

46. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

47. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

48. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

49. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactca	Protospacer
****************************

50. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

51. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

52. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

53. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

54. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

55. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

56. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

57. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

58. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

59. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagactctgactcagacagc	CRISPR spacer
ctcagactctgactcagacagc	Protospacer
**********************

60. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

61. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

62. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

63. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

64. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

65. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

66. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

67. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

68. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagactcagatagc	Protospacer
**********************

69. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
****************************************************

70. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
****************************************************

71. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagcgacagc	Protospacer
**********************************************

72. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgatagcgattcagactcagactcagatagcgactctgattca	Protospacer
**********************************************

73. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagactcagatagc	Protospacer
**********************************************

74. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagactcagatagc	Protospacer
**********************************************

75. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagactcagatagc	Protospacer
**********************************************

76. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagactcagatagc	Protospacer
**********************************************

77. spacer 1.34|19157|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagatagcgatagcgactcagactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactcagacagc	Protospacer
**********************************************

78. spacer 1.34|19157|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagatagcgatagcgactcagactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactcagacagc	Protospacer
**********************************************

79. spacer 1.34|19157|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagatagcgatagcgactcagactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactcagacagc	Protospacer
**********************************************

80. spacer 1.35|19235|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
****************************************************

81. spacer 1.35|19235|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
****************************************************

82. spacer 1.35|19235|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
****************************************************

83. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctctgactcagacagcgactcagactcagacagc	Protospacer
**********************************

84. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctctgactcagacagcgactcagactcagacagc	Protospacer
**********************************

85. spacer 1.37|19385|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagcgactctgacgcagatagc	CRISPR spacer
ttcagactcagactcagatagcgactctgacgcagatagc	Protospacer
****************************************

86. spacer 1.37|19385|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagactcagatagcgactctgacgcagatagc	CRISPR spacer
ttcagactcagactcagatagcgactctgacgcagatagc	Protospacer
****************************************

87. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactcagacagc	Protospacer
**********************************************

88. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactcagacagc	Protospacer
**********************************************

89. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactcagacagc	Protospacer
**********************************************

90. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

91. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

92. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

93. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

94. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

95. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

96. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

97. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

98. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

99. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

100. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

101. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
**********************

102. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ttcagactcagacagcgatagcgattcagactcagactca	Protospacer
****************************************

103. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ttcagactcagacagcgatagcgattcagactcagactca	Protospacer
****************************************

104. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagacagc	Protospacer
****************************************

105. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagacagc	Protospacer
****************************************

106. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
ttcagactctgattcagatagcgactctgattcagacagcgatagc	Protospacer
**********************************************

107. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagcgattcagactcagacgcagatagc	Protospacer
****************************************

108. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

109. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

110. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

111. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

112. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

113. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

114. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

115. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

116. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

117. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

118. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

119. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

120. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

121. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

122. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
**********************************

123. spacer 1.14|17669|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

tagcgattcagactcagatagcgatagcgactcagactctgactca	CRISPR spacer
tagcgattcagactcagatagcgatagcgactcagactcagactca	Protospacer
*************************************** ******

124. spacer 1.14|17669|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

tagcgattcagactcagatagcgatagcgactcagactctgactca	CRISPR spacer
tagcgattcagactcagatagcgatagcgactcagactcagactca	Protospacer
*************************************** ******

125. spacer 1.14|17669|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

tagcgattcagactcagatagcgatagcgactcagactctgactca	CRISPR spacer
tagcgattcagactcagatagcgatagcgactcagactcagactca	Protospacer
*************************************** ******

126. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgactcagacagcgatagcgactctgactcagacagc	Protospacer
*** ************************************

127. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgactcagacagcgatagcgactctgactcagacagc	Protospacer
*** ************************************

128. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
tagcgactctgactcagacagcgacagcgactctgattca	Protospacer
********* ******************************

129. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
tagcgactctgactcagacagcgacagcgactctgattca	Protospacer
********* ******************************

130. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

131. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

132. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

133. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

134. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

135. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

136. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

137. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

138. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

139. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

140. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

141. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

142. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

143. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

144. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

145. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

146. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

147. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

148. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

149. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

150. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

151. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctcagactcagacagcgatagc	Protospacer
*** ******************

152. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

153. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

154. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

155. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

156. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

157. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

158. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

159. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

160. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

161. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

162. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

163. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctcagactcagacagcgatagc	Protospacer
*** ******************

164. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

165. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

166. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgattcagacagcgatagc	Protospacer
******.***************

167. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctctgactcagacagcgatagc	CRISPR spacer
ctctgactcagacagcgacagc	Protospacer
******************.***

168. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagatagcgatagc	Protospacer
******.***************************************

169. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagatagcgatagc	Protospacer
******.***************************************

170. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

171. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

172. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

173. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

174. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

175. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

176. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

177. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

178. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagc	Protospacer
********************************* ******

179. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgacagcgattca	Protospacer
.*********************

180. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgacagcgattca	Protospacer
.*********************

181. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgacagcgattca	Protospacer
.*********************

182. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgacagcgattca	Protospacer
.*********************

183. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

184. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

185. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

186. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

187. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

188. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

189. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

190. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

191. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

192. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

193. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

194. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

195. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

196. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

197. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

198. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

199. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

200. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

201. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

202. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

203. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

204. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

205. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagatagcgacagcgattca	Protospacer
******.***************

206. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

207. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgacagcgattca	CRISPR spacer
ttcagacagcgatagcgattca	Protospacer
************.*********

208. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactct	Protospacer
*************************** 

209. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactct	Protospacer
*************************** 

210. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactct	Protospacer
*************************** 

211. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagactct	Protospacer
*************************** 

212. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagattca	Protospacer
************************.***

213. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagtgattcagattca	Protospacer
************************.***

214. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctcagactctgactcagacagc	CRISPR spacer
ctcagactcagactcagacagc	Protospacer
********* ************

215. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctcagactctgactcagacagc	CRISPR spacer
ctcagactcagactcagacagc	Protospacer
********* ************

216. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctcagactctgactcagacagc	CRISPR spacer
ctcagactcagactcagacagc	Protospacer
********* ************

217. spacer 1.28|18731|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ctcagactctgactcagacagc	CRISPR spacer
ctcagactcagactcagacagc	Protospacer
********* ************

218. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagacgcagatagc	Protospacer
************* ********

219. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.981

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
********* ******************************************

220. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.981

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
********* ******************************************

221. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.981

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
********* ******************************************

222. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.981

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattcagacagcgatagcgattcagactct	Protospacer
*************************** ************************

223. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgactcagacagcgatagcgactctgactcagacagcgacagc	Protospacer
******.***************************************

224. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagcgatagc	Protospacer
******************************************.***

225. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagcgatagc	Protospacer
******************************************.***

226. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagcgatagc	Protospacer
******************************************.***

227. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagcgatagc	Protospacer
******************************************.***

228. spacer 1.34|19157|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ttcagactcagatagcgatagcgactcagactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactcagacagc	Protospacer
********************************* ************

229. spacer 1.34|19157|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ttcagactcagatagcgatagcgactcagactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactcagacagc	Protospacer
********************************* ************

230. spacer 1.34|19157|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ttcagactcagatagcgatagcgactcagactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactcagacagc	Protospacer
********************************* ************

231. spacer 1.35|19235|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.981

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
********* ******************************************

232. spacer 1.35|19235|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.981

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	Protospacer
********* ******************************************

233. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctctgactcagacagcgactctgactcagacagc	Protospacer
********************* ************

234. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagc	Protospacer
*** ******************************

235. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagc	Protospacer
*** ******************************

236. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagc	Protospacer
*** ******************************

237. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagc	Protospacer
*** ******************************

238. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagc	Protospacer
*** ******************************

239. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagc	Protospacer
*** ******************************

240. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.971

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagc	Protospacer
*** ******************************

241. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactcagacagc	Protospacer
********************************* ************

242. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactcagacagc	Protospacer
********************************* ************

243. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.978

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactcagacagc	Protospacer
********************************* ************

244. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

245. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

246. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

247. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

248. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

249. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

250. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

251. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

252. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.*********************

253. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactca	Protospacer
******************.***

254. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactca	Protospacer
******************.***

255. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactca	Protospacer
******************.***

256. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttctgacagcgatagcgattca	Protospacer
*** ******************

257. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactca	Protospacer
******************.***

258. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactca	Protospacer
******************.***

259. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgacagcgattca	Protospacer
************.*********

260. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttctgacagcgatagcgattca	Protospacer
*** ******************

261. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttctgacagcgatagcgattca	Protospacer
*** ******************

262. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgacagcgattca	Protospacer
************.*********

263. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactca	Protospacer
******************.***

264. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgacagcgattca	Protospacer
************.*********

265. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttctgacagcgatagcgattca	Protospacer
*** ******************

266. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttctgacagcgatagcgattca	Protospacer
*** ******************

267. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactca	Protospacer
******************.***

268. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagattcagacagc	Protospacer
************************.*********

269. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactctgacagc	Protospacer
*************************** ******

270. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagattcagacagc	Protospacer
************************.*********

271. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactctgacagc	Protospacer
*************************** ******

272. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactctgacagc	Protospacer
*************************** ******

273. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactctgacagc	Protospacer
*************************** ******

274. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagc	Protospacer
*** **.*********************************

275. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagc	Protospacer
*** **.*********************************

276. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagc	Protospacer
*** **.*********************************

277. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagc	Protospacer
*** **.*********************************

278. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagc	Protospacer
*** **.*********************************

279. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctcagactcagatagcgatagcgactctgattcagacagc	Protospacer
************.*****************.*********

280. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagc	Protospacer
*** **.*********************************

281. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagc	Protospacer
*** **.*********************************

282. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctcagactcagatagcgatagcgactctgattcagacagc	Protospacer
************.*****************.*********

283. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagc	Protospacer
*** **.*********************************

284. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactctgacgca	Protospacer
********************************* *** **

285. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactctgattca	Protospacer
********************************* **.***

286. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactctgacgca	Protospacer
********************************* *** **

287. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
cagcgactctgactcagacagcgacagcgactctgattca	Protospacer
.******** ******************************

288. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
tagcgactcagactcagatagcgatagcgactctgattca	Protospacer
******************.*****.***************

289. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
tagcgactcagactcagatagcgatagcgactctgattca	Protospacer
******************.*****.***************

290. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ttcagactcagacagcgatagc	Protospacer
.** ******************

291. spacer 1.22|18359|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ctctgactcagacagcgatagc	CRISPR spacer
ttcagactcagacagcgatagc	Protospacer
.** ******************

292. spacer 1.25|18563|22|NZ_CP035292|CRT matches to CP054891 (Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagactctgactcagactca	CRISPR spacer
ctcagactcagactcagactca	Protospacer
.******** ************

293. spacer 1.25|18563|22|NZ_CP035292|CRT matches to CP054891 (Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagactctgactcagactca	CRISPR spacer
ctcagactcagactcagactca	Protospacer
.******** ************

294. spacer 1.25|18563|22|NZ_CP035292|CRT matches to CP054891 (Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagactctgactcagactca	CRISPR spacer
ctcagactcagactcagactca	Protospacer
.******** ************

295. spacer 1.25|18563|22|NZ_CP035292|CRT matches to NZ_CP026099 (Shigella flexneri strain FDAARGOS_74 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcagactctgactcagactca	CRISPR spacer
ctcagactcagactcagactca	Protospacer
.******** ************

296. spacer 1.25|18563|22|NZ_CP035292|CRT matches to NZ_CP026099 (Shigella flexneri strain FDAARGOS_74 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcagactctgactcagactca	CRISPR spacer
ctcagactcagactcagactca	Protospacer
.******** ************

297. spacer 1.25|18563|22|NZ_CP035292|CRT matches to NZ_CP026099 (Shigella flexneri strain FDAARGOS_74 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcagactctgactcagactca	CRISPR spacer
ctcagactcagactcagactca	Protospacer
.******** ************

298. spacer 1.25|18563|22|NZ_CP035292|CRT matches to MG592621 (Vibrio phage 1.255.O._10N.286.45.F1, partial genome) position: , mismatch: 2, identity: 0.909

ttcagactctgactcagactca	CRISPR spacer
ttcagactcagactcagactcg	Protospacer
********* ***********.

299. spacer 1.25|18563|22|NZ_CP035292|CRT matches to MG592609 (Vibrio phage 1.244.A._10N.261.54.C3, partial genome) position: , mismatch: 2, identity: 0.909

ttcagactctgactcagactca	CRISPR spacer
ttcagactcagactcagactcg	Protospacer
********* ***********.

300. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

301. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

302. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

303. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

304. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

305. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

306. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

307. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

308. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagacagcgatagcgattca	Protospacer
.***********.*********

309. spacer 1.26|18617|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ctcagatagcgacagcgattca	Protospacer
.*****.***************

310. spacer 1.26|18617|22|NZ_CP035292|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcagacagcgacagcgattca	CRISPR spacer
ttccgacagcgacagcgattcg	Protospacer
*** *****************.

311. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagactct	Protospacer
***************.*********** 

312. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ttcagatagcgacagtgattcagactca	CRISPR spacer
ctcagatagcgacagcgattcagactca	Protospacer
.**************.************

313. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagactca	Protospacer
*************  *************

314. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagactca	Protospacer
*************  *************

315. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagacagcgacagcgattcagactca	Protospacer
******.********.************

316. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagactca	Protospacer
*************  *************

317. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagacagcgacagcgattcagactca	Protospacer
******.********.************

318. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagactcagactcagatagc	CRISPR spacer
ctcagactcagactcagacagc	Protospacer
.*****************.***

319. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagactcagactcagatagc	CRISPR spacer
ctcagactcagactcagacagc	Protospacer
.*****************.***

320. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagactcagactcagatagc	CRISPR spacer
ctcagactcagactcagacagc	Protospacer
.*****************.***

321. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagactcagactcagatagc	CRISPR spacer
ctcagactcagactcagacagc	Protospacer
.*****************.***

322. spacer 1.29|18785|22|NZ_CP035292|CRT matches to NZ_CP016746 (Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagactcagactcagatagc	CRISPR spacer
ttcagactcagattcagatagt	Protospacer
************.********.

323. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.962

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattcagacagcgatagcgactcagactct	Protospacer
*************************** **************.*********

324. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.962

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattcagacagcgatagcgactcagactct	Protospacer
*************************** **************.*********

325. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.962

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattcagacagcgatagcgactcagactct	Protospacer
*************************** **************.*********

326. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.962

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattcagacagcgatagcgactcagactct	Protospacer
*************************** **************.*********

327. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.962

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattcagacagcgatagcgactcagactct	Protospacer
*************************** **************.*********

328. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgactcagacagcgatagcgactctgactcagacagcgatagc	Protospacer
******.***********************************.***

329. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgattcagacagcgatagc	Protospacer
******************************.***********.***

330. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgatagcgattcagactcagactcagatagcgactctgacgca	Protospacer
******************************************. **

331. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgatagcgattcagactcagactcagatagcgactcagactca	Protospacer
*************************************** **.***

332. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgatagcgattcagactcagactcagatagcgactctgacgca	Protospacer
******************************************. **

333. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgatagcgattcagactcagactcagatagcgactcagactca	Protospacer
*************************************** **.***

334. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgatagcgattcagactctgattcagatagcgactctgattca	Protospacer
********************* **.*********************

335. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ttcagactcagacagcgatagcgattcagactcagactcagatagc	Protospacer
.** ******************************************

336. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ttcagactcagacagcgatagcgattcagactcagactcagatagc	Protospacer
.** ******************************************

337. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ctctgactcagacagcgatagcgactcagactcagactcagacagc	Protospacer
************************.*****************.***

338. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ctctgattcagacagcgacagcgattcagactcagactcagatagc	Protospacer
******.***********.***************************

339. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.957

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ctctgattcagacagcgacagcgattcagactcagactcagatagc	Protospacer
******.***********.***************************

340. spacer 1.35|19235|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.962

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattcagacagcgatagcgattcagactca	Protospacer
*************************** *********************** 

341. spacer 1.35|19235|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.962

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactcagacagcgactctgattcagacagcgatagcgattcagactct	Protospacer
********* ***************** ************************

342. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctctgactcagatagcgactcagactcagatagc	Protospacer
************.*****************.***

343. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactctgactcagacagc	Protospacer
*** ***************** ************

344. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctctgactcagacagcgactctgattcagacagc	Protospacer
********************* **.*********

345. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctctgactcagatagcgactcagactcagatagc	Protospacer
************.*****************.***

346. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagattcagacagcgactcagactcagacagc	Protospacer
*** **.***************************

347. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagc	Protospacer
*** ********************.*********

348. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagattcagacagcgactcagactcagacagc	Protospacer
*** **.***************************

349. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagc	Protospacer
*** ********************.*********

350. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagactcagatagc	Protospacer
*** **************************.***

351. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagattcagacagcgactcagactcagacagc	Protospacer
*** **.***************************

352. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagc	Protospacer
*** ********************.*********

353. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagattcagacagcgactcagactcagacagc	Protospacer
*** **.***************************

354. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagc	Protospacer
*** ********************.*********

355. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagc	Protospacer
*** ********************.*********

356. spacer 1.37|19385|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagactcagatagcgactctgacgcagatagc	CRISPR spacer
ttcagactcagactcagatagcgactcagactcagatagc	Protospacer
*************************** *** ********

357. spacer 1.37|19385|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagactcagatagcgactctgacgcagatagc	CRISPR spacer
ttcagactcagactcagatagcgactcagactcagatagc	Protospacer
*************************** *** ********

358. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

359. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

360. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

361. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

362. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgatagcgactca	Protospacer
.*****************.***

363. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

364. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgacagcgattca	Protospacer
.***********.*********

365. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

366. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ctcagatagcgatagcgattca	Protospacer
.*****.***************

367. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

368. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgacagcgattca	Protospacer
.***********.*********

369. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

370. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

371. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

372. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgatagcgactct	Protospacer
******************.** 

373. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgacagcgattca	Protospacer
.***********.*********

374. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ctcagacagcgacagcgattca	Protospacer
.***********.*********

375. spacer 1.39|19535|22|NZ_CP035292|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 2, identity: 0.909

ttcagacagcgatagcgattca	CRISPR spacer
ttcagacagcgctagcgattcc	Protospacer
*********** ********* 

376. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagactca	Protospacer
.** ************************************

377. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagactca	Protospacer
.** ************************************

378. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagactca	Protospacer
.** ************************************

379. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagactca	Protospacer
.** ************************************

380. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
************.***********.***************

381. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
************.***********.***************

382. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.95

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
************.***********.***************

383. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgactctgattcagactcagacagc	Protospacer
*************  *******************

384. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgactctgattcagactcagacagc	Protospacer
*************  *******************

385. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgactctgattcagactcagacagc	Protospacer
*************  *******************

386. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagattcagacagcgatagcgactctgactcagatagc	Protospacer
.*****.*****************************.***

387. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagattcagacagcgatagcgactctgactcagatagc	Protospacer
.*****.*****************************.***

388. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagacagc	Protospacer
.***********.************** ************

389. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagacagc	Protospacer
.***********.************** ************

390. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
cagcgactcagactcagacagcgatagcgactctgactca	Protospacer
.***********************.***********.***

391. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
cagcgactcagactcagacagcgatagcgactctgactca	Protospacer
.***********************.***********.***

392. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ttcagatagcgacagtgattcagactca	CRISPR spacer
ctcagatagcgatagcgattcagactca	Protospacer
.***********.**.************

393. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ttcagatagcgacagtgattcagactca	CRISPR spacer
ctcagacagcgacagcgattcagactca	Protospacer
.*****.********.************

394. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ttcagatagcgacagtgattcagactca	CRISPR spacer
ctcagacagcgacagcgattcagactca	Protospacer
.*****.********.************

395. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.942

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattcagacagcgatagcgattcagactca	Protospacer
********* ***************** *********************** 

396. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.935

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagcgactct	Protospacer
*******************************************  .

397. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.935

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagcgactca	Protospacer
*******************************************   

398. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.935

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ctctgattcagacagcgatagcgactctgactcagacagcgactca	Protospacer
*******************************************   

399. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagactcagacagcgactctgactcagacagc	Protospacer
.** ***************** ************

400. spacer 1.36|19319|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttccgactcagacagcgactcggactcagacagc	Protospacer
.**.*****************.************

401. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.935

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ctctgactcagacagcgatagcgactcagactcagactcagacagc	Protospacer
.** ********.*********************************

402. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgatagcgactcagactcagactca	Protospacer
.** ********************.***************

403. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
*************************************   

404. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
*************************************   

405. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
*************************************   

406. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgatagcgactctgactcagacagc	Protospacer
.***********.************** ************

407. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ctcagactcagatagcgatagcgattcagactcagatagc	Protospacer
.***********************.***********.***

408. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ctcagactcagatagcgatagcgactctgattcagacagc	Protospacer
.************************** **.*********

409. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ctcagactcagatagcgatagcgactctgattcagacagc	Protospacer
.************************** **.*********

410. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.925

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ctcagactcagacagcgatagcgactctgactcagacagc	Protospacer
.***********.************** ************

411. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcagatagcgacagcgattcagactcagatagc	Protospacer
.**************.**************.***

412. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcagacagcgacagcgattcagactcagacagc	Protospacer
.*****.********.******************

413. spacer 1.12|17465|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.938

cagcgattcagactcagactcagatagcgatagcgactctgattcagatagcgacagtga	CRISPR spacer
cagcgattcagactcagactcagatagcgatagcgactctgattcagatagcgacagtga	Protospacer
************************************************************

414. spacer 1.12|17465|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.938

cagcgattcagactcagactcagatagcgatagcgactctgattcagatagcgacagtga	CRISPR spacer
cagcgattcagactcagactcagatagcgatagcgactctgattcagatagcgacagtga	Protospacer
************************************************************

415. spacer 1.14|17669|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.913

tagcgattcagactcagatagcgatagcgactcagactctgactca	CRISPR spacer
tagcgattcagactcagatagcgatagcgactcagactcagacagc	Protospacer
*************************************** ***   

416. spacer 1.17|17927|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.938

ctctgacgcagatagcgatagcgactctgactcagacagcgatagcgattcagactcaga	CRISPR spacer
ctctgacgcagatagcgatagcgactctgactcagacagcgatagcgattcagactcaga	Protospacer
************************************************************

417. spacer 1.17|17927|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.938

ctctgacgcagatagcgatagcgactctgactcagacagcgatagcgattcagactcaga	CRISPR spacer
ctctgacgcagatagcgatagcgactctgactcagacagcgatagcgattcagactcaga	Protospacer
************************************************************

418. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactcagactcagacagcgacagcgactctgattca	Protospacer
.   ************************************

419. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactcagactcagacagcgacagcgactctgattca	Protospacer
.   ************************************

420. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactcagactcagacagcgacagcgactctgattca	Protospacer
.   ************************************

421. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagatagcgacagcgattcagactctgactca	Protospacer
*********************.***************   

422. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagc	Protospacer
*  .***************************** ******

423. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagc	Protospacer
*  .***************************** ******

424. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagc	Protospacer
*  .***************************** ******

425. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagc	Protospacer
*  .***************************** ******

426. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagc	Protospacer
*  .***************************** ******

427. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagc	Protospacer
*  .***************************** ******

428. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagacagc	Protospacer
***************.*********   

429. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagacagc	Protospacer
***************.*********   

430. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagacagc	Protospacer
***************.*********   

431. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagacagc	Protospacer
***************.*********   

432. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagacagc	Protospacer
***************.*********   

433. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.913

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
cagcgattcagacagcgatagcgattcagactcagactcagatagc	Protospacer
*  .**.***************************************

434. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ttcagactcagacagcgacagcgattcagactcagataaa	Protospacer
******************.*****************.  *

435. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactca	Protospacer
********************************* ***   

436. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactca	Protospacer
********************************* ***   

437. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.9

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactctgactca	Protospacer
********************************* ***   

438. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.913

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
tagcgactctgattcagacagcgactctgattcagacagcgatagc	Protospacer
*   **************.***************************

439. spacer 1.45|19985|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.938

ctctgattcagacagcgatagcgactcagactctgactcagacagcgacagcgattcaga	CRISPR spacer
ctctgattcagacagcgatagcgactcagactctgactcagacagcgacagcgattcaga	Protospacer
************************************************************

440. spacer 1.14|17669|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.891

tagcgattcagactcagatagcgatagcgactcagactctgactca	CRISPR spacer
cagcgattcagactcagatagcgatagcgactcagactcagacagc	Protospacer
.************************************** ***   

441. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ctctgactcagacagcgatagcgactcagactcagactca	Protospacer
*** *********************** *********   

442. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactctgactcagacagcgacagcgactctgattca	Protospacer
.   ***** ******************************

443. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactctgactcagacagcgacagcgactctgattca	Protospacer
.   ***** ******************************

444. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactctgactcagacagcgacagcgactctgattca	Protospacer
.   ***** ******************************

445. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactctgactcagacagcgacagcgactctgattca	Protospacer
.   ***** ******************************

446. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactctgactcagacagcgacagcgactctgattca	Protospacer
.   ***** ******************************

447. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactctgactcagacagcgacagcgactctgattca	Protospacer
.   ***** ******************************

448. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactctgactcagacagcgacagcgactctgattca	Protospacer
.   ***** ******************************

449. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ctcagactctgactcagacagcgacagcgactctgattca	Protospacer
.   ***** ******************************

450. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
tagcgactcagactcagacagcgacagcgattcagatagc	Protospacer
******************************.** ***   

451. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ttcagactcagactcagatagcgatagcgactctgattca	Protospacer
*   **************.*****.***************

452. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ttcagactcagactcagatagcgatagcgactctgattca	Protospacer
*   **************.*****.***************

453. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ttcagactcagactcagatagcgatagcgactctgattca	Protospacer
*   **************.*****.***************

454. spacer 1.20|18197|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tagcgactcagactcagacagcgacagcgactctgattca	CRISPR spacer
ttcagactcagactcagatagcgatagcgactctgattca	Protospacer
*   **************.*****.***************

455. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.914

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagc	Protospacer
*  .***************  *************************************

456. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.914

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagc	Protospacer
*  .***************  *************************************

457. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.914

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagc	Protospacer
*  .***************  *************************************

458. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.914

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagc	Protospacer
*  .***************  *************************************

459. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.914

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagc	Protospacer
*  .***************  *************************************

460. spacer 1.21|18269|58|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.914

ctctgattcagatagcgactctgattcagactcagacagcgactctgattcagacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagc	Protospacer
*  .***************  *************************************

461. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagattcagacagc	Protospacer
*  .**************************.** ******

462. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
cagcgattcagatagcgacagtgattcagattcagacagc	Protospacer
*  .**************************.** ******

463. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagatagc	Protospacer
***************.********.   

464. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagatagc	Protospacer
***************.********.   

465. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagatagc	Protospacer
***************.********.   

466. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagatagc	Protospacer
***************.********.   

467. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagatagc	Protospacer
***************.********.   

468. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagatagc	Protospacer
***************.********.   

469. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgacagcgattcagatagc	Protospacer
***************.********.   

470. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagacagc	Protospacer
*************  **********   

471. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagacagc	Protospacer
*************  **********   

472. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagacagc	Protospacer
*************  **********   

473. spacer 1.35|19235|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.904

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattcagacagcgatagcgattcagatagc	Protospacer
*************************** ********************.  .

474. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
cagcgattcagatagcgactcagactcagacagc	Protospacer
*  .**.*****.*********************

475. spacer 1.37|19385|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ttcagactcagactcagatagcgactctgacgcagatagc	CRISPR spacer
tagcgactcagactcagatagcgactcagactcagatagc	Protospacer
*   *********************** *** ********

476. spacer 1.37|19385|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ttcagactcagactcagatagcgactctgacgcagatagc	CRISPR spacer
tagcgactcagactcagatagcgactcagactcagatagc	Protospacer
*   *********************** *** ********

477. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
cagcgattcagacagcgatagcgattcagactcagactca	Protospacer
.   **.*********************************

478. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagacagc	Protospacer
************.***********.************   

479. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagacagc	Protospacer
************.***********.************   

480. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagacagcgatagcgattcagactcagactca	Protospacer
************.***********.************   

481. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ttcagactcagacagcgatagcgattcagactcagactca	Protospacer
************.***********.************   

482. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagacagcgacagcgattcagactcagactca	Protospacer
******.********.***************   

483. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgacagcgattcagactctgactca	Protospacer
***************.*********** ***   

484. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagacagcgacagcgattcagactcagactca	Protospacer
******.********.***************   

485. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
.***********.************** *********   

486. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagactcagacagcgatagcgattcagactcagactca	Protospacer
.***********************.** *********   

487. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
.***********.************** *********   

488. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagactcagatagcgatagcgactcagactcagactca	Protospacer
.***********.************** *********   

489. spacer 1.16|17855|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ctcagactcagacagcgatagcgactctgactcagacagc	CRISPR spacer
ttcagactcagacagcgatagcgattcagactcagactca	Protospacer
.***********************.** *********   

490. spacer 1.17|17927|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.906

ctctgacgcagatagcgatagcgactctgactcagacagcgatagcgattcagactcaga	CRISPR spacer
ctctgactcagacagcgatagcgactctgactcagacagcgatagcgattcagactcaga	Protospacer
******* ****.***********************************************

491. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagatagc	Protospacer
*************  *********.   

492. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagatagc	Protospacer
*************  *********.   

493. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagatagc	Protospacer
*************  *********.   

494. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagacagcgacagcgattcagatagc	Protospacer
******.********.********.   

495. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttcagatagcgacagtgattcagactca	CRISPR spacer
ctcagatagcgactctgattcagacagc	Protospacer
.************  **********   

496. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagatagc	Protospacer
*************  *********.   

497. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttcagatagcgacagtgattcagactca	CRISPR spacer
ttcagatagcgactctgattcagatagc	Protospacer
*************  *********.   

498. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.885

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcagactctgacagcgactctgattcagacagcgatagcgattcagatagc	Protospacer
********* ***************** ********************.  .

499. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ttcagattcagacagcgatagcgactctgactcagatagcgactca	Protospacer
.** ********************************.******   

500. spacer 1.31|18923|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

ctctgattcagacagcgatagcgactctgactcagacagcgacagc	CRISPR spacer
ttcagattcagacagcgatagcgactctgactcagatagcgactca	Protospacer
.** ********************************.******   

501. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgatagcgattcagactcagactcagatagcgatagcgactct	Protospacer
************************************.  .**.** 

502. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgatagcgattcagactcagactcagatagcgatagcgactct	Protospacer
************************************.  .**.** 

503. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagactcagacagcgattcagactcagacgca	Protospacer
.** **************.************.  

504. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagatagcgatagcgactcagactcagacagc	Protospacer
*** **.   **.*********************

505. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagatagcgatagcgactcagactcagacagc	Protospacer
*** **.   **.*********************

506. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagatagc	Protospacer
.** ********************************.   

507. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctcagactcagatagcgatagcgattcagactcagatagc	Protospacer
.***********.***********************.   

508. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgatagcgattcagactcagatagc	Protospacer
.** ********************************.   

509. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctcagactcagacagcgatagcgactctgactcagacagc	Protospacer
.***********************.** *********   

510. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctcagactcagacagcgatagcgactctgactcagacagc	Protospacer
.***********************.** *********   

511. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgacagcgattcagactcagacagc	Protospacer
.** **************.******************   

512. spacer 1.41|19661|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

ttcagactcagatagcgatagcgactcagactcagacagc	CRISPR spacer
ctctgactcagacagcgatagcgactcagactcagactca	Protospacer
.** ********.************************   

513. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
cagcgactctgactcagacagcgactctgattcagacagcgatagc	Protospacer
.   ********.*****.***************************

514. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
ttcagactcagactcagatagcgactctgattcagacagcgactct	Protospacer
********* **.*****************************.  .

515. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcagacagcgacagcgattcagactcagataaa	Protospacer
.*****.********.**************.*. 

516. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactcagacagtgattcagattcagacagc	Protospacer
***.**.   **************.*********

517. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactcagacagtgattcagattcagacagc	Protospacer
***.**.   **************.*********

518. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactcagacagtgattcagattcagacagc	Protospacer
***.**.   **************.*********

519. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactcagacagtgattcagattcagacagc	Protospacer
***.**.   **************.*********

520. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgactcagactca	Protospacer
.   ***   ******************************

521. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgactcagactca	Protospacer
.   ***   ******************************

522. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.825

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagtgattcagactcagatagcgactcagactca	Protospacer
      .******      ***************************

523. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.825

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagatagcgactcagactcagacagcgactcagactca	Protospacer
*   ***   **************.***************

524. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.825

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagtgattcagactcagatagcgactcagactca	Protospacer
      .******      ***************************

525. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.825

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagtgattcagactcagatagcgactcagactca	Protospacer
      .******      ***************************

526. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.825

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagtgattcagactcagatagcgactcagactca	Protospacer
      .******      ***************************

527. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.825

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagatagcgactcagactcagacagcgactcagactca	Protospacer
*   ***   **************.***************

528. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 7, identity: 0.825

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagtgattcagactcagatagcgactcagactca	Protospacer
      .******      ***************************

529. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 7, identity: 0.825

------tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
atcagatagc------gactcagactcagacagcgactcagactca	Protospacer
      ****      **************.***************

530. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgactcagactctgactcagacagc	Protospacer
************************.******** **.   **.***

531. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgactcagactctgactcagacagc	Protospacer
************************.******** **.   **.***

532. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgactcagactctgactcagacagc	Protospacer
************************.******** **.   **.***

533. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgactcagacagcgatagcgactcagactcagactcagacagc	Protospacer
******.*****************.***********.   **.***

534. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgactcagactctgactcagacagc	Protospacer
************************.******** **.   **.***

535. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgactcagactctgactcagacagc	Protospacer
************************.******** **.   **.***

536. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgactcagactctgactcagacagc	Protospacer
************************.******** **.   **.***

537. spacer 1.23|18413|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ctctgattcagacagcgatagcgattcagactcagatagcgatagc	CRISPR spacer
ctctgattcagacagcgatagcgactcagactctgactcagacagc	Protospacer
************************.******** **.   **.***

538. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

ttcagatagcgacagtgattcagactca	CRISPR spacer
ctcagacagcgacagcgattcagatagc	Protospacer
.*****.********.********.   

539. spacer 1.27|18671|28|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

ttcagatagcgacagtgattcagactca	CRISPR spacer
ctcagacagcgacagcgattcagatagc	Protospacer
.*****.********.********.   

540. spacer 1.30|18839|52|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.865

ttcagactcagacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ctcagactcagacagcgactctgattcagacagcgacagcgattcagatagc	Protospacer
.************************** ********.***********.  .

541. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgacagcgattcagactcagactcagatagcgatagcgactct	Protospacer
******.*****************************.  .**.** 

542. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
cagcgacagcgattcagactcagactcagatagcgatagcgactct	Protospacer
******.*****************************.  .**.** 

543. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcagatagcgacagcgattcagactcagatagc	Protospacer
*** **.   ********.***********.***

544. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 7, identity: 0.794

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
agatacatcagatagcgactcagactcagacagc	Protospacer
   *.  *****.*********************

545. spacer 1.36|19319|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ctcggatagcgacagcgactcggactctgacagc	Protospacer
*** **.   ***********.***** ******

546. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ctcagactcagatagcgatagcgattcagactcagatagcgatagc	Protospacer
.***********************.***********.   **.***

547. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgattcagacagcgatagcgattcagactcagatagc	Protospacer
.** **.*****************************.   

548. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgattcagacagcgatagcgattcagactcagatagc	Protospacer
.** **.*****************************.   

549. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgattcagacagcgatagcgattcagactcagatagc	Protospacer
.** **.*****************************.   

550. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgattcagacagcgatagcgattcagactcagatagc	Protospacer
.** **.*****************************.   

551. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctcagactcagatagcgacagcgattcagactcagatagc	Protospacer
.***********.*****.*****************.   

552. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
cagcgactctgattcagatagcgactctgattcagatagcgacagt	Protospacer
.   ********************************.*****.**.

553. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcggactccgacagtgattccgattcagacagc	Protospacer
.**.**.  ************ **.*********

554. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcggactccgacagtgattcggactcggacagc	Protospacer
.**.**.  ************.*****.******

555. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactctgacagtgattccgattcagacagc	Protospacer
***.**.  .*********** **.*********

556. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactctgacagtgattccgactctgacagc	Protospacer
***.**.  .*********** ***** ******

557. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactctgacagtgattccgactctgacagc	Protospacer
***.**.  .*********** ***** ******

558. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactctgacagtgattccgactctgacagc	Protospacer
***.**.  .*********** ***** ******

559. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactctgacagtgattccgactctgacagc	Protospacer
***.**.  .*********** ***** ******

560. spacer 1.46|20081|34|NZ_CP035292|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 7, identity: 0.794

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcggactctgacagtgattccgactctgacagc	Protospacer
***.**.  .*********** ***** ******

561. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.8

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactcagactca	Protospacer
*   **.   **************.***************

562. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.8

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagatagcgactcagactcagacagcgactcagattca	Protospacer
*   ***   **************.***********.***

563. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.8

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagcgattcagattcagatagcgactcagactca	Protospacer
      .******      *****.*********************

564. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.8

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagatagcgattcagattcagatagcgactcagactca	Protospacer
*   ***   **.*****.*********************

565. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactcagactca	Protospacer
*   **.   **************.***************

566. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagcgattcagattcagatagcgactcagactca	Protospacer
      .******      *****.*********************

567. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

------tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
atcagatagc------gactcagattcaggtagcgactcagactca	Protospacer
      ****      ********.****.****************

568. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 8, identity: 0.8

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgattcagactca	Protospacer
.   ***   ********************.*********

569. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 8, identity: 0.8

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagatagcgactcagactcagacagcgactcagattca	Protospacer
*   ***   **************.***********.***

570. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 8, identity: 0.8

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagcgattcagattcagatagcgactcagactca	Protospacer
      .******      *****.*********************

571. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 8, identity: 0.8

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagatagcgactcagactcagacagcgactcagattca	Protospacer
*   ***   **************.***********.***

572. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 8, identity: 0.8

tagcgattcagac------tcagactcagatagcgactcagactca	CRISPR spacer
------ctcagacagcgattcagattcagatagcgactcagactca	Protospacer
      .******      *****.*********************

573. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
tagcgatagcgactcagactcagactcagacagcgacagcgactct	Protospacer
.***********.*****************.******  .**.** 

574. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
tagcgatagcgactcagactcagactcagacagcgacagcgactct	Protospacer
.***********.*****************.******  .**.** 

575. spacer 1.32|19001|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

cagcgatagcgattcagactcagactcagatagcgactctgattca	CRISPR spacer
tagcgatagcgactcagactcagactcagacagcgacagcgactct	Protospacer
.***********.*****************.******  .**.** 

576. spacer 1.33|19079|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

ctctgactcagacagcgatagcgattcagactcagactcagatagc	CRISPR spacer
ctctgactcagacagcgacagcgattcagactcagacagcgactct	Protospacer
******************.******************   **.  .

577. spacer 1.34|19157|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

ttcagactcagatagcgatagcgactcagactctgactcagacagc	CRISPR spacer
ctcagactcagatagcgatagcgattcagactcagatagcgatagc	Protospacer
.***********************.******** **.   **.***

578. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

579. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

580. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

581. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

582. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

583. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

584. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
cgcagatagcgatagcgactctgactcagacagc	Protospacer
* * **.   **.******** ************

585. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

586. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

587. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

588. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

589. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
cgcagatagcgatagcgactctgactcagacagc	Protospacer
* * **.   **.******** ************

590. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

591. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

592. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

593. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

594. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagcgactctgattcagacagc	Protospacer
.** **.   *********** **.*********

595. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
ttcagatagcgacagtgattcagactcagacagc	Protospacer
.** **.   *****.**.***************

596. spacer 1.36|19319|34|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.765

ctctgactcagacagcgactcagactcagacagc	CRISPR spacer
agatacatcagatagcgactcagattcagacagc	Protospacer
   *.  *****.***********.*********

597. spacer 1.38|19457|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

ttcagactcagatagcgatagcgactcagactcagactcagacagc	CRISPR spacer
ctcagactcagatagcgacagcgattcagactcagatagcgatagc	Protospacer
.*****************.*****.***********.   **.***

598. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
cagcgatagcgattcagatagcgactctgattcagacagcgatagc	Protospacer
.   **.  .************************************

599. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
cagcgatagcgattcagatagcgactctgattcagacagcgatagc	Protospacer
.   **.  .************************************

600. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagatagcgactcagactcagatagcgacagc	Protospacer
.***********.*****.***********..  **.***

601. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.8

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagcgattca	Protospacer
.*****************.************.  ***   

602. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.8

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagatagcgactcagactcagatagtgattcc	Protospacer
************.*****.***********..  ***  *

603. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagcgattca	Protospacer
.*****************.************.  ***   

604. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagatagcgactcagactcagatagtgattcc	Protospacer
************.*****.***********..  ***  *

605. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagatagcgactcagactcagatagtgattcc	Protospacer
************.*****.***********..  ***  *

606. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 8, identity: 0.8

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagcgactcc	Protospacer
.*****************.************.  **.  *

607. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 8, identity: 0.8

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagatagcgattcagactcagatagtgattcc	Protospacer
.***********.*****************..  ***  *

608. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctctgactcagacagcgactcagactcagacagc	Protospacer
.** **.   *****.**.***************

609. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctctgactcagacagcgactcagactcagacagc	Protospacer
.** **.   *****.**.***************

610. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcggactctgacagtgattccgactctgacagc	Protospacer
.**.**.  .*********** ***** ******

611. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcggactctgacagtgattccgactctgacagc	Protospacer
.**.**.  .*********** ***** ******

612. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcggactctgacagtgattccgattcagacagc	Protospacer
.**.**.  .*********** **.*********

613. spacer 1.46|20081|34|NZ_CP035292|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctctgactcggacagtgattccgactctgacagc	Protospacer
.** **.   *********** ***** ******

614. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactcagactca	Protospacer
.   **.   **************.***************

615. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgattcagactca	Protospacer
*   **.   ********.***********.*********

616. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgactcagattca	Protospacer
*   **.   ********.*****************.***

617. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactcagactca	Protospacer
.   **.   **************.***************

618. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagacagcgactcagactcagatagcgactccgattca	Protospacer
*   **.   *********************** **.***

619. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgattcagactca	Protospacer
*   **.   ********.***********.*********

620. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcaggtagcgactcagactcagacagcgactcagattca	Protospacer
*   *.*   **************.***********.***

621. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgattcagactca	Protospacer
*   **.   ********.***********.*********

622. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgattcagactca	Protospacer
*   **.   ********.***********.*********

623. spacer 1.24|18491|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.775

ctctgattcagatagcgacagtgattcagactctgacagc	CRISPR spacer
ctctgattcagacagcgacagcgattcagatagcgactca	Protospacer
************.********.********.  .***   

624. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctcagactcagacagcgacagcgattcagatagcgacagt	Protospacer
.*****************.***********.   ***   

625. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagcgactct	Protospacer
.*****************.************.  **.  .

626. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagtgattcagactcagatagcgactca	Protospacer
***************.**************..  **.   

627. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagcgattcagattcagatagcgactca	Protospacer
************************.*****..  **.   

628. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagcgactca	Protospacer
.*****************.************.  **.   

629. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagcgactca	Protospacer
.*****************.************.  **.   

630. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgattcagattcagatagcgattcg	Protospacer
.***********************.*****..  ***   

631. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagacagcgactcagactcagacagcgactcc	Protospacer
.*****.***********.************.  **.  *

632. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagatagcgattcagactcagacagcgattca	Protospacer
.*****.*****.******************.  ***   

633. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagtgattcagactcagatagcgactca	Protospacer
***************.**************..  **.   

634. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagtgattcagactcagatagcgactca	Protospacer
***************.**************..  **.   

635. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagtgattcagactcagatagcgactca	Protospacer
***************.**************..  **.   

636. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagactcagacagcgactca	Protospacer
.*****************.************.  **.   

637. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagcgattcagattcagatagcgactca	Protospacer
************************.*****..  **.   

638. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagactcagatagcgactcc	Protospacer
.*****************.***********..  **.  *

639. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgattcagattcagatagcgattcg	Protospacer
.***********************.*****..  ***   

640. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagatagcgactcagactcagatagtgattca	Protospacer
************.*****.***********..  ***   

641. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagatagcgattcagactcagacagcgattca	Protospacer
.*****.*****.******************.  ***   

642. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagtgattcagactcagatagcgactca	Protospacer
***************.**************..  **.   

643. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagcgattcagattcagatagcgactca	Protospacer
************************.*****..  **.   

644. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagacagcgattcagattcagatagcgactca	Protospacer
************************.*****..  **.   

645. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ttcagactcagatagcgactcagactcagatagcgattca	Protospacer
************.*****.***********..  ***   

646. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagacagcgactcagactcagacagcgactcc	Protospacer
.*****.***********.************.  **.  *

647. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagatagcgattcagactcagacagcgattca	Protospacer
.*****.*****.******************.  ***   

648. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagcgattca	Protospacer
.*****************.*****.******.  ***   

649. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 9, identity: 0.775

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagatagcgattcagactcagacagcgattca	Protospacer
.*****.*****.******************.  ***   

650. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgactctgattcagatagcgactct	Protospacer
*************  *********.   ***  .

651. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagatagcgactctgattcagatagcgactct	Protospacer
*************  *********.   ***  .

652. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ttcagacagcgacagcgattcagatagcgactca	Protospacer
******.********.********.   ***   

653. spacer 1.46|20081|34|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
ctcagatagcgactctgattcagacagcgactct	Protospacer
.************  **********   ***  .

654. spacer 1.6|16793|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.857

tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	CRISPR spacer
tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	Protospacer
************************************************************

655. spacer 1.7|16895|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.857

tagcgattcagatagcgactctgattcagatagcgactctgattcagactcagacagcga	CRISPR spacer
tagcgattcagatagcgactctgattcagatagcgactctgattcagactcagacagcga	Protospacer
************************************************************

656. spacer 1.7|16895|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.857

tagcgattcagatagcgactctgattcagatagcgactctgattcagactcagacagcga	CRISPR spacer
tagcgattcagatagcgactctgattcagatagcgactctgattcagactcagacagcga	Protospacer
************************************************************

657. spacer 1.18|18023|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.857

cagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	Protospacer
************************************************************

658. spacer 1.18|18023|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.857

cagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	Protospacer
************************************************************

659. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 10, identity: 0.75

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgactcagactca	Protospacer
.   **.   ********.*****.***************

660. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 10, identity: 0.75

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgactcagactca	Protospacer
.   **.   ********.*****.***************

661. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 10, identity: 0.75

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactcagattca	Protospacer
.   **.   **************.***********.***

662. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.75

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagacagcgactcagactcagatagcgactccgattca	Protospacer
.   **.   *********************** **.***

663. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.75

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgactcagactca	Protospacer
.   **.   ********.*****.***************

664. spacer 1.19|18125|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 10, identity: 0.75

tagcgattcagactcagactcagatagcgactcagactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgactcagactca	Protospacer
.   **.   ********.*****.***************

665. spacer 1.40|19589|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgatagcgattcagactcagactca	CRISPR spacer
ctctgactcagacagcgacagcgattcagatagcgacagt	Protospacer
.** **************.***********.   ***   

666. spacer 1.42|19733|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.857

ttcagactcagacagcgactctgattcagatagcgacagcgattcagatagcgacagtga	CRISPR spacer
ttcagactcagacagcgactctgattcagatagcgacagcgattcagatagcgacagtga	Protospacer
************************************************************

667. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactctgactcagacagcgactct	Protospacer
.*****************.** *********.  **.  .

668. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagcgactca	Protospacer
.*****************.*****.******.  **.   

669. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagacagcgactcagactcagacagcgactca	Protospacer
.*****.***********.************.  **.   

670. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagcgactca	Protospacer
.*****************.*****.******.  **.   

671. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagacagcgactcagactcagacagcgactca	Protospacer
.*****.***********.************.  **.   

672. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagcgactca	Protospacer
.*****************.*****.******.  **.   

673. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagactcagacagcgactcagattcagacagcgactca	Protospacer
.*****************.*****.******.  **.   

674. spacer 1.44|19913|40|NZ_CP035292|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 10, identity: 0.75

ttcagactcagacagcgattcagactcagacgcagatagc	CRISPR spacer
ctcagattcagacagcgattcagattcagatagcgattcg	Protospacer
.*****.*****************.*****..  ***   

675. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.706

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
cagcgactctgacagtgattccgactctgacagc	Protospacer
.   **.  .*********** ***** ******

676. spacer 1.46|20081|34|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.706

ttcagatagcgacagtgattcagactcagacagc	CRISPR spacer
cagcgactctgacagtgattccgactctgacagc	Protospacer
.   **.  .*********** ***** ******

677. spacer 1.12|17465|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.828

cagcgattcagactcagactcagatagcgatagcgactctgattcagatagcgacagtga	CRISPR spacer
ctcagatagcgactcagactcagatagcgatagcgactctgattcagatagcgacagcga	Protospacer
*   ***   ***********************************************.**

678. spacer 1.12|17465|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.828

cagcgattcagactcagactcagatagcgatagcgactctgattcagatagcgacagtga	CRISPR spacer
ctcagatagcgactcagactcagatagcgatagcgactctgattcagatagcgacagcga	Protospacer
*   ***   ***********************************************.**

679. spacer 1.18|18023|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.843

cagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	CRISPR spacer
tagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	Protospacer
.***********************************************************

680. spacer 1.18|18023|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.843

cagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	CRISPR spacer
tagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	Protospacer
.***********************************************************

681. spacer 1.35|19235|52|NZ_CP035292|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 11, identity: 0.788

ttcagactctgacagcgactctgattctgacagcgatagcgattcagactct	CRISPR spacer
ttcggactctgacagcgactcggattctgacagcgattcggatagcgacagc	Protospacer
***.***************** ***************   ***   ***  .

682. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.761

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
cagcgatagcgattcagatagcgactctgattcagatagcgacagt	Protospacer
.   **.  .**************************.*****.**.

683. spacer 1.43|19835|46|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.761

ttcagactctgattcagatagcgactctgattcagacagcgatagc	CRISPR spacer
cagcgatagcgattcagatagcgactctgattcagatagcgacagt	Protospacer
.   **.  .**************************.*****.**.

684. spacer 1.6|16793|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 14, identity: 0.8

tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	CRISPR spacer
tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagactcaga	Protospacer
******************************************************.   **

685. spacer 1.6|16793|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 15, identity: 0.786

tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	CRISPR spacer
tagcgattcagactctgacagcgactctgattcagacagcgatagcgactctgattcaga	Protospacer
************************************************.** ***   **

686. spacer 1.7|16895|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 15, identity: 0.786

tagcgattcagatagcgactctgattcagatagcgactctgattcagactcagacagcga	CRISPR spacer
ttcagactcagacagcgactctgattcagatagcgactctgattcagactcagacagcga	Protospacer
*   **.*****.***********************************************

687. spacer 1.17|17927|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 15, identity: 0.766

ctctgacgcagatagcgatagcgactctgactcagacagcgatagcgattcagactcaga	CRISPR spacer
cagcgatagcgattcagatagcgactctgattcagacagcgatagcgattcagactcaga	Protospacer
*  .**..  ***   **************.*****************************

688. spacer 1.6|16793|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.771

tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	CRISPR spacer
tagcgattcagactctgacagcgactctgattcagacagcgatagcgactctgactcaga	Protospacer
************************************************.** **.   **

689. spacer 1.6|16793|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.771

tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	CRISPR spacer
tagcgattcagactctgacagcgactctgattcagacagcgatagcgactctgactcaga	Protospacer
************************************************.** **.   **

690. spacer 1.10|17243|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.789

cagcgattcagacagcgatagcgattcagatagcgactctgattcagacagcgatagcga	CRISPR spacer
cagcgattcagacagcgatagcgattcagatagcgactctgattcagacagcgatagcga	Protospacer
************************************************************

691. spacer 1.13|17561|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.789

cagcgactctgattcagatagcgacagtgattcagactcagacagcgactctgattctga	CRISPR spacer
cagcgactctgattcagatagcgacagtgattcagactcagacagcgactctgattctga	Protospacer
************************************************************

692. spacer 1.15|17747|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.789

cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	CRISPR spacer
cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	Protospacer
************************************************************

693. spacer 1.15|17747|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.789

cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	CRISPR spacer
cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	Protospacer
************************************************************

694. spacer 1.15|17747|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.789

cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	CRISPR spacer
cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	Protospacer
************************************************************

695. spacer 1.17|17927|64|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.75

ctctgacgcagatagcgatagcgactctgactcagacagcgatagcgattcagactcaga	CRISPR spacer
tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagactcaga	Protospacer
.  .**. ****.  .**.***********.*****************************

696. spacer 1.6|16793|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.757

tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	CRISPR spacer
cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	Protospacer
.**.***************************** ********************.  .**

697. spacer 1.6|16793|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.757

tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	CRISPR spacer
cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	Protospacer
.**.***************************** ********************.  .**

698. spacer 1.6|16793|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.757

tagcgattcagactctgacagcgactctgattcagacagcgatagcgattcagatagcga	CRISPR spacer
cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	Protospacer
.**.***************************** ********************.  .**

699. spacer 1.13|17561|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.776

cagcgactctgattcagatagcgacagtgattcagactcagacagcgactctgattctga	CRISPR spacer
tagcgactctgattcagatagcgacagtgattcagactcagacagcgactctgattctga	Protospacer
.***********************************************************

700. spacer 1.13|17561|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.776

cagcgactctgattcagatagcgacagtgattcagactcagacagcgactctgattctga	CRISPR spacer
cagcgactctgattcagatagcgacagtgattcagactctgacagcgactctgattctga	Protospacer
*************************************** ********************

701. spacer 1.13|17561|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.776

cagcgactctgattcagatagcgacagtgattcagactcagacagcgactctgattctga	CRISPR spacer
cagcgactctgattcagatagcgacagtgattcagactctgacagcgactctgattctga	Protospacer
*************************************** ********************

702. spacer 1.13|17561|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.776

cagcgactctgattcagatagcgacagtgattcagactcagacagcgactctgattctga	CRISPR spacer
cagcgactctgattcagatagcgacagtgattcagactctgacagcgactctgattctga	Protospacer
*************************************** ********************

703. spacer 1.15|17747|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.776

cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	CRISPR spacer
cagtgattcagactcagacagcgactctgattctgacagcgatagcgattcagactctga	Protospacer
*************** ********************************************

704. spacer 1.15|17747|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 17, identity: 0.776

cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactctga	CRISPR spacer
cagtgattcagactcagacagcgactctgattctgacagcgatagcgattcagactctga	Protospacer
*************** ********************************************

705. spacer 1.7|16895|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 19, identity: 0.729

tagcgattcagatagcgactctgattcagatagcgactctgattcagactcagacagcga	CRISPR spacer
ctcagatagcgatagcgactctgattcagatagcgacagtgattcagactcagacagcga	Protospacer
.   ***   ***************************  *********************

706. spacer 1.15|17747|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 20, identity: 0.737

cagtgattcagactctgacagcgactctgattctgacagcgatagcgattcagactct--	CRISPR spacer
cagtgattcagactcagacagcgactctgattcagacagcgatagcgattcagactctga	Protospacer
*************** ***************** ************************  

707. spacer 1.11|17351|82|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 22, identity: 0.732

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	Protospacer
************************************************************

708. spacer 1.11|17351|82|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 22, identity: 0.732

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	Protospacer
************************************************************

709. spacer 1.11|17351|82|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 22, identity: 0.732

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	Protospacer
************************************************************

710. spacer 1.11|17351|82|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 22, identity: 0.732

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	Protospacer
************************************************************

711. spacer 1.11|17351|82|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 22, identity: 0.732

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	Protospacer
************************************************************

712. spacer 1.11|17351|82|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 22, identity: 0.732

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	Protospacer
************************************************************

713. spacer 1.42|19733|70|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 22, identity: 0.686

ttcagactcagacagcgactctgattcagatagcgacagcgattcagatagcgacagtga	CRISPR spacer
tagcgatagcgactcagactctgactcagacagcgacagcgattcagatagcgacagtga	Protospacer
*   **.   ***   ********.*****.*****************************

714. spacer 1.13|17561|76|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 24, identity: 0.684

cagcgactctgattcagatagcgacagtgattcagactcagacagcgactctgattctga	CRISPR spacer
tgaagacagcgattcagatagcgacagtgattcagactcagacagcgactctgattcaga	Protospacer
... ***  .*********************************************** **

715. spacer 1.11|17351|82|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 26, identity: 0.683

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagcgactctgattctgacagcga	Protospacer
*  .*********************************************** ********

716. spacer 1.11|17351|82|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 26, identity: 0.683

cagcgattcagatagcgacagtgattcagactcagacagcgactctgattcagacagcga	CRISPR spacer
ctctgattcagatagcgacagtgattcagactcagacagcgactctgattctgacagcga	Protospacer
*  .*********************************************** ********

717. spacer 1.4|16541|88|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 28, identity: 0.682

tagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	CRISPR spacer
tagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	Protospacer
************************************************************

718. spacer 1.8|16997|88|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 28, identity: 0.682

tagcgactcagactcagactcagacagcgactctgactcagacagcgactctgattcaga	CRISPR spacer
tagcgactcagactcagactcagacagcgactctgactcagacagcgactctgattcaga	Protospacer
************************************************************

719. spacer 1.4|16541|88|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 29, identity: 0.67

tagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	Protospacer
.***********************************************************

720. spacer 1.4|16541|88|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 29, identity: 0.67

tagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagcgattcagatagcga	Protospacer
.***********************************************************

721. spacer 1.9|17117|94|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 34, identity: 0.638

cagcgattcagatagcgacagtgattcagattcagacagcgatagcgactctgactcaga	CRISPR spacer
cagcgattcagatagcgacagtgattcagattcagacagcgatagcgactctgactcaga	Protospacer
************************************************************

722. spacer 1.9|17117|94|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 34, identity: 0.638

cagcgattcagatagcgacagtgattcagattcagacagcgatagcgactctgactcaga	CRISPR spacer
cagcgattcagatagcgacagtgattcagattcagacagcgatagcgactctgactcaga	Protospacer
************************************************************

723. spacer 1.1|16121|100|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 40, identity: 0.6

tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	CRISPR spacer
tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	Protospacer
************************************************************

724. spacer 1.1|16121|100|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 40, identity: 0.6

tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	CRISPR spacer
tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	Protospacer
************************************************************

725. spacer 1.2|16253|100|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 40, identity: 0.6

tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	CRISPR spacer
tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	Protospacer
************************************************************

726. spacer 1.2|16253|100|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 40, identity: 0.6

tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	CRISPR spacer
tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	Protospacer
************************************************************

727. spacer 1.5|16661|100|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 40, identity: 0.6

tagcgactctgactcagacagcgactctgactcagacagcgatagcgactctgactcaga	CRISPR spacer
tagcgactctgactcagacagcgactctgactcagacagcgatagcgactctgactcaga	Protospacer
************************************************************

728. spacer 1.3|16385|124|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 64, identity: 0.484

tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	CRISPR spacer
tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	Protospacer
************************************************************

729. spacer 1.3|16385|124|NZ_CP035292|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 64, identity: 0.484

tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	CRISPR spacer
tagcgactcagactctgactcagacagcgacagcgactctgattcagatagcgacagcga	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP035291
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035291_1 2219325-2219412 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 877769 : 951699 67 uncultured_Caudovirales_phage(18.18%) integrase,transposase,protease,tRNA attL 882223:882240|attR 949897:949914
DBSCAN-SWA_2 1065850 : 1092171 29 Staphylococcus_phage(91.67%) transposase NA
DBSCAN-SWA_3 1365517 : 1375372 11 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_4 1688110 : 1753576 81 Staphylococcus_phage(51.85%) integrase,protease,tRNA,capsid,portal,terminase,head,tail attL 1713160:1713176|attR 1757269:1757285
DBSCAN-SWA_5 1831533 : 1840003 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2068306 : 2082062 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_7 2096358 : 2104506 9 Pandoravirus(12.5%) transposase NA
DBSCAN-SWA_8 2402545 : 2418237 22 uncultured_Caudovirales_phage(44.44%) terminase,integrase attL 2411909:2411924|attR 2426080:2426095
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage