Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP035296 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence 1 crisprs csa3,Cas14u_CAS-V 1 1 6 1
NZ_CP035297 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed3, complete sequence 0 crisprs csa3 0 0 2 0
NZ_CP035295 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed1, complete sequence 0 crisprs csa3,WYL 0 0 0 0
NZ_CP035294 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 chromosome, complete genome 1 crisprs csa3,DEDDh,cas3,DinG 0 0 7 0

Results visualization

1. NZ_CP035296
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035296_1 1743-1891 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296.1 1319-1361 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296.1 1605-1647 0 1.0

1. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to position: 1319-1361, mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

2. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to position: 1605-1647, mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP027421 Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence 19510-19552 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP027421 Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence 19606-19648 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP027421 Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence 19702-19744 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP027421 Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence 19798-19840 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP027421 Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence 20083-20125 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 28074-28116 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_MN602039 Staphylococcus capitis strain APC2923 plasmid pJOS_01, complete sequence 34471-34513 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_MN602039 Staphylococcus capitis strain APC2923 plasmid pJOS_01, complete sequence 34567-34609 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_MN602039 Staphylococcus capitis strain APC2923 plasmid pJOS_01, complete sequence 34762-34804 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 65379-65421 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 65665-65707 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 66045-66087 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_007351 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence 22176-22218 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_007351 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence 22367-22409 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_007351 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence 22653-22695 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_KU882686 Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence 37712-37754 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_KU882686 Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence 37903-37945 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_KU882686 Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence 37999-38041 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP022091 Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence 6060-6102 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP022091 Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence 6346-6388 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP022091 Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence 6537-6579 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence 1319-1361 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence 1605-1647 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence 1796-1838 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 35435-35477 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 35530-35572 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 1503-1545 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 1886-1928 0 1.0
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP027421 Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence 19414-19456 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP027421 Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence 19893-19935 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP027421 Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence 19988-20030 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 27978-28020 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 28169-28211 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 28264-28306 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 28359-28401 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 65283-65325 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 65474-65516 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 65569-65611 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 65760-65802 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 65855-65897 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_015432 Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence 65950-65992 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_007351 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence 22080-22122 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_007351 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence 22463-22505 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_007351 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence 22558-22600 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_KU882686 Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence 37808-37850 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_KU882686 Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence 38095-38137 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP022091 Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence 6155-6197 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP022091 Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence 6250-6292 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP022091 Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence 6633-6675 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence 1414-1456 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence 1509-1551 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence 1892-1934 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 35721-35763 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 35625-35667 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 1598-1640 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 1694-1736 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 1790-1832 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 1982-2024 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP054577 Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence 10520-10562 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP054577 Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence 10616-10658 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP054577 Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence 10712-10754 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP054577 Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence 10807-10849 1 0.977
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NC_007351 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence 22272-22314 2 0.953
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP022091 Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence 6441-6483 2 0.953
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP035296 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence 1700-1742 2 0.953
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 22863-22905 2 0.953
NZ_CP035296_1 1.1|1796|43|NZ_CP035296|CRISPRCasFinder 1796-1838 43 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 22767-22809 2 0.953

1. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP027421 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

2. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP027421 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

3. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP027421 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

4. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP027421 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

5. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP027421 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

6. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

7. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_MN602039 (Staphylococcus capitis strain APC2923 plasmid pJOS_01, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

8. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_MN602039 (Staphylococcus capitis strain APC2923 plasmid pJOS_01, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

9. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_MN602039 (Staphylococcus capitis strain APC2923 plasmid pJOS_01, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

10. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

11. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

12. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

13. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_007351 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

14. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_007351 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

15. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_007351 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

16. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_KU882686 (Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

17. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_KU882686 (Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

18. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_KU882686 (Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

19. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP022091 (Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

20. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP022091 (Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

21. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP022091 (Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

22. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP035296 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

23. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP035296 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

24. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP035296 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

25. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

26. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

27. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

28. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaac	Protospacer
*******************************************

29. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP027421 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

30. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP027421 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

31. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP027421 (Staphylococcus cohnii strain FDAARGOS_334 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

32. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

33. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

34. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

35. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

36. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

37. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

38. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

39. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

40. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

41. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_015432 (Staphylococcus saprophyticus subsp. saprophyticus MS1146 plasmid pSSAP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

42. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_007351 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

43. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_007351 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

44. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_007351 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

45. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_KU882686 (Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

46. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_KU882686 (Staphylococcus lugdunensis strain Tlug63N-4 plasmid pT63N, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

47. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP022091 (Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

48. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP022091 (Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

49. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP022091 (Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

50. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP035296 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

51. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP035296 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

52. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP035296 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

53. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

54. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaatacaaagaatatataagaatgaattaagaacaac	Protospacer
*********.*********************************

55. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

56. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

57. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

58. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

59. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP054577 (Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

60. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP054577 (Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

61. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP054577 (Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

62. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP054577 (Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence) position: , mismatch: 1, identity: 0.977

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
******************************************.

63. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NC_007351 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence) position: , mismatch: 2, identity: 0.953

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
gacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
.*****************************************.

64. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP022091 (Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.953

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
gacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
.*****************************************.

65. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP035296 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.953

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
gacaaacaacacaaagaatatataagaatgaattaagaacaat	Protospacer
.*****************************************.

66. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 2, identity: 0.953

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaacaacacaaagaatatataagaatgaattaggaacaat	Protospacer
***********************************.******.

67. spacer 1.1|1796|43|NZ_CP035296|CRISPRCasFinder matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 2, identity: 0.953

aacaaacaacacaaagaatatataagaatgaattaagaacaac	CRISPR spacer
aacaaaaaacacgaagaatatataagaatgaattaagaacaac	Protospacer
****** *****.******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4536 5 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 8780 : 12895 6 Staphylococcus_phage(75.0%) NA NA
DBSCAN-SWA_3 17496 : 19614 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 24130 : 24805 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_5 28564 : 29239 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_6 33852 : 36577 4 Pandoravirus(50.0%) transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP035296.1|WP_002509686.1|3092_3227_-|hypothetical-protein 3092_3227_- 44 aa aa NA NA NA 0-4536 yes
2. NZ_CP035297
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4135 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_2 12902 : 22635 8 Staphylococcus_phage(60.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP035294
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035294_1 279974-280071 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1004757 : 1019063 16 Staphylococcus_phage(92.31%) NA NA
DBSCAN-SWA_2 1023431 : 1033568 10 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 1162212 : 1171338 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_4 1297642 : 1307610 11 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_5 1785982 : 1794457 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_6 2029683 : 2048413 14 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_7 2056716 : 2064266 9 Pandoravirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage