Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040747 Bacillus altitudinis strain HQ-51-Ba chromosome, complete genome 1 crisprs csa3,DEDDh,WYL,DinG,cas3 2 2 9 0
NZ_CP040746 Bacillus altitudinis strain HQ-51-Ba plasmid punnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP040745 Bacillus altitudinis strain HQ-51-Ba plasmid punnamed2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP040747
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040747_1 776315-776537 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP040747.1 776538-776568 1 0.968
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP040747.1 776538-776568 1 0.968

1. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to position: 776538-776568, mismatch: 1, identity: 0.968

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
gaacaggtgccacgggagcaaccggtgcaac	Protospacer
*******.***********************

2. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to position: 776538-776568, mismatch: 1, identity: 0.968

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
gaacaggtgccacgggagcaaccggtgcaac	Protospacer
*******.***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531071-531101 6 0.806
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531179-531209 6 0.806
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531287-531317 6 0.806
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531503-531533 6 0.806
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 126-156 6 0.806
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 553196-553226 6 0.806
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 648033-648063 6 0.806
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531071-531101 6 0.806
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531179-531209 6 0.806
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531287-531317 6 0.806
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531503-531533 6 0.806
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 126-156 6 0.806
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 553196-553226 6 0.806
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 648033-648063 6 0.806
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 MN694114 Marine virus AFVG_250M252, complete genome 19687-19717 7 0.774
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 MN694114 Marine virus AFVG_250M252, complete genome 19687-19717 7 0.774
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP034331 Tabrizicola piscis strain K13M18 plasmid unnamed3, complete sequence 1409-1439 9 0.71
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 63973-64003 9 0.71
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 294972-295002 9 0.71
NZ_CP040747_1 1.1|776371|31|NZ_CP040747|PILER-CR 776371-776401 31 NZ_CP041223 Porphyrobacter sp. YT40 plasmid pYT40, complete sequence 27600-27630 9 0.71
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP034331 Tabrizicola piscis strain K13M18 plasmid unnamed3, complete sequence 1409-1439 9 0.71
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 63973-64003 9 0.71
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 294972-295002 9 0.71
NZ_CP040747_1 1.2|776458|31|NZ_CP040747|PILER-CR 776458-776488 31 NZ_CP041223 Porphyrobacter sp. YT40 plasmid pYT40, complete sequence 27600-27630 9 0.71

1. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

2. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

3. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

4. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

5. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

6. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

7. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

8. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

9. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

10. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

11. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

12. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

13. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

14. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 6, identity: 0.806

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgaccggcgccacaggagcaaccggtgatac	Protospacer
 .** ********.*************  **

15. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to MN694114 (Marine virus AFVG_250M252, complete genome) position: , mismatch: 7, identity: 0.774

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgcagggcgcaacgggagcaaccggcgcaac	Protospacer
 .  .***** **************.*****

16. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to MN694114 (Marine virus AFVG_250M252, complete genome) position: , mismatch: 7, identity: 0.774

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
cgcagggcgcaacgggagcaaccggcgcaac	Protospacer
 .  .***** **************.*****

17. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP034331 (Tabrizicola piscis strain K13M18 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
tctccggcgtcacgggagcaaccggagccgt	Protospacer
   * ****.*************** ** ..

18. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
tttctggcgtcacgggagcaaccggggccgt	Protospacer
   * ****.*************** ** ..

19. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
tttctggcgtcacgggagcaaccggggccgt	Protospacer
   * ****.*************** ** ..

20. spacer 1.1|776371|31|NZ_CP040747|PILER-CR matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 9, identity: 0.71

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
tttctggcgtcacgggagcaaccggagccgt	Protospacer
   * ****.*************** ** ..

21. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP034331 (Tabrizicola piscis strain K13M18 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
tctccggcgtcacgggagcaaccggagccgt	Protospacer
   * ****.*************** ** ..

22. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
tttctggcgtcacgggagcaaccggggccgt	Protospacer
   * ****.*************** ** ..

23. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
tttctggcgtcacgggagcaaccggggccgt	Protospacer
   * ****.*************** ** ..

24. spacer 1.2|776458|31|NZ_CP040747|PILER-CR matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 9, identity: 0.71

gaacaggcgccacgggagcaaccggtgcaac	CRISPR spacer
tttctggcgtcacgggagcaaccggagccgt	Protospacer
   * ****.*************** ** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22177 : 30891 8 uncultured_Mediterranean_phage(16.67%) tRNA NA
DBSCAN-SWA_2 592748 : 669330 97 uncultured_Caudovirales_phage(40.82%) terminase,portal,tail,protease,holin,integrase,head,tRNA,coat attL 593653:593667|attR 621997:622011
DBSCAN-SWA_3 681683 : 691579 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_4 1693077 : 1699326 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_5 2056493 : 2064201 10 Ostreococcus_lucimarinus_virus(16.67%) NA NA
DBSCAN-SWA_6 2102260 : 2108646 10 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_7 2749279 : 2774049 34 Bacillus_phage(26.09%) terminase,plate,portal,tail,holin,capsid NA
DBSCAN-SWA_8 3101101 : 3110108 10 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_9 3354868 : 3403571 57 Escherichia_phage(25.0%) coat,protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage