Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042177 Burkholderia sp. KBS0801 chromosome 1, complete sequence 5 crisprs cas3,DEDDh,csa3,c2c9_V-U4,DinG,RT 0 0 3 0
NZ_CP042178 Burkholderia sp. KBS0801 chromosome 2, complete sequence 1 crisprs Cas14u_CAS-V,DEDDh,csa3,DinG,cas3,c2c9_V-U4 0 0 0 0
NZ_CP042179 Burkholderia sp. KBS0801 chromosome 3, complete sequence 1 crisprs Cas14u_CAS-V,csa3,c2c9_V-U4,cas14j 0 1 0 0

Results visualization

1. NZ_CP042177
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042177_1 591741-591835 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042177_2 1207078-1207179 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042177_3 1825810-1825918 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042177_4 2426319-2426390 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042177_5 3288973-3289080 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 406618 : 448654 38 Pseudomonas_phage(20.0%) protease,integrase,transposase,plate attL 401316:401332|attR 429876:429892
DBSCAN-SWA_2 842531 : 849713 7 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_3 3408864 : 3442929 25 Erwinia_phage(25.0%) protease,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP042178
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042178_1 2330317-2330403 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP042179
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042179_1 962601-962677 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042179_1 1.1|962624|31|NZ_CP042179|CRISPRCasFinder 962624-962654 31 NZ_CP034087 Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence 48052-48082 7 0.774
NZ_CP042179_1 1.1|962624|31|NZ_CP042179|CRISPRCasFinder 962624-962654 31 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 856894-856924 8 0.742
NZ_CP042179_1 1.1|962624|31|NZ_CP042179|CRISPRCasFinder 962624-962654 31 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 512907-512937 9 0.71
NZ_CP042179_1 1.1|962624|31|NZ_CP042179|CRISPRCasFinder 962624-962654 31 CP016641 Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence 2693-2723 9 0.71

1. spacer 1.1|962624|31|NZ_CP042179|CRISPRCasFinder matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 7, identity: 0.774

ggcggtcacatcggcggtcgcggaaacccaa	CRISPR spacer
ggcggtcacagcggcggtcgcgggcggacag	Protospacer
********** ************. .  **.

2. spacer 1.1|962624|31|NZ_CP042179|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.742

ggcggtcacatcggcggtcgcggaaacccaa	CRISPR spacer
ggcggtcgcgtcggcggtcgcggcgacgtcg	Protospacer
*******.*.************* .** . .

3. spacer 1.1|962624|31|NZ_CP042179|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

ggcggtcacatcggcggtcgcggaaacccaa	CRISPR spacer
ggcggccacgtcggcggtcgcggagctgtcg	Protospacer
*****.***.**************. . . .

4. spacer 1.1|962624|31|NZ_CP042179|CRISPRCasFinder matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 9, identity: 0.71

ggcggtcacatcggcggtcgcggaaacccaa	CRISPR spacer
ggcagtcacagcggcggtcgcggcggcgttg	Protospacer
***.****** ************ ..* . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage