Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP040823 Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 5 crisprs NA 1 6 0 0
NZ_CP040824 Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP040818 Paraoceanicella profunda strain D4M1 chromosome, complete genome 4 crisprs WYL,RT,DEDDh,csa3 0 0 5 0

Results visualization

1. NZ_CP040820
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP040824
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP040819
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040819_1 3339-3482 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040819_2 63281-63346 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040819_3 63629-63783 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040819_4 564364-564449 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040819_5 583116-583259 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP040818.1 3191430-3191448 1 0.947
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP040820.1 6060-6078 1 0.947
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP040820.1 286359-286377 1 0.947
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP040824.1 86102-86120 2 0.895
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP040822.1 125445-125463 2 0.895

1. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to position: 3191430-3191448, mismatch: 1, identity: 0.947

tgctggcggcgctggccgt	CRISPR spacer
tgctggcggcgctggcggt	Protospacer
**************** **

2. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to position: 6060-6078, mismatch: 1, identity: 0.947

tgctggcggcgctggccgt	CRISPR spacer
tggtggcggcgctggccgt	Protospacer
** ****************

3. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to position: 286359-286377, mismatch: 1, identity: 0.947

tgctggcggcgctggccgt	CRISPR spacer
tggtggcggcgctggccgt	Protospacer
** ****************

4. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to position: 86102-86120, mismatch: 2, identity: 0.895

tgctggcggcgctggccgt	CRISPR spacer
tgctggtggcgctggcagt	Protospacer
******.********* **

5. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to position: 125445-125463, mismatch: 2, identity: 0.895

tgctggcggcgctggccgt	CRISPR spacer
tgccggcggggctggccgt	Protospacer
***.***** *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040819_1 1.1|3386|50|NZ_CP040819|CRISPRCasFinder 3386-3435 50 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 3386-3435 0 1.0
NZ_CP040819_1 1.1|3386|50|NZ_CP040819|CRISPRCasFinder 3386-3435 50 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 583163-583212 0 1.0
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 155221-155239 0 1.0
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 326843-326861 0 1.0
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 71696-71714 0 1.0
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 11258-11276 0 1.0
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 538222-538240 0 1.0
NZ_CP040819_2 2.1|63304|19|NZ_CP040819|CRISPRCasFinder 63304-63322 19 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 63304-63322 0 1.0
NZ_CP040819_3 3.1|63652|34|NZ_CP040819|CRISPRCasFinder 63652-63685 34 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 63652-63685 0 1.0
NZ_CP040819_3 3.2|63709|52|NZ_CP040819|CRISPRCasFinder 63709-63760 52 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 63709-63760 0 1.0
NZ_CP040819_4 4.1|564387|40|NZ_CP040819|CRISPRCasFinder 564387-564426 40 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 564387-564426 0 1.0
NZ_CP040819_5 5.1|583163|50|NZ_CP040819|CRISPRCasFinder 583163-583212 50 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 3386-3435 0 1.0
NZ_CP040819_5 5.1|583163|50|NZ_CP040819|CRISPRCasFinder 583163-583212 50 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 583163-583212 0 1.0
NZ_CP040819_3 3.1|63652|34|NZ_CP040819|CRISPRCasFinder 63652-63685 34 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 929165-929198 9 0.735

1. spacer 1.1|3386|50|NZ_CP040819|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcacggacggcttcggcccgcccgggccgggttcgcgcgttcgggagcc	CRISPR spacer
ggcacggacggcttcggcccgcccgggccgggttcgcgcgttcgggagcc	Protospacer
**************************************************

2. spacer 1.1|3386|50|NZ_CP040819|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcacggacggcttcggcccgcccgggccgggttcgcgcgttcgggagcc	CRISPR spacer
ggcacggacggcttcggcccgcccgggccgggttcgcgcgttcgggagcc	Protospacer
**************************************************

3. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

tgctggcggcgctggccgt	CRISPR spacer
tgctggcggcgctggccgt	Protospacer
*******************

4. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 0, identity: 1.0

tgctggcggcgctggccgt	CRISPR spacer
tgctggcggcgctggccgt	Protospacer
*******************

5. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgctggcggcgctggccgt	CRISPR spacer
tgctggcggcgctggccgt	Protospacer
*******************

6. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgctggcggcgctggccgt	CRISPR spacer
tgctggcggcgctggccgt	Protospacer
*******************

7. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 0, identity: 1.0

tgctggcggcgctggccgt	CRISPR spacer
tgctggcggcgctggccgt	Protospacer
*******************

8. spacer 2.1|63304|19|NZ_CP040819|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 0, identity: 1.0

tgctggcggcgctggccgt	CRISPR spacer
tgctggcggcgctggccgt	Protospacer
*******************

9. spacer 3.1|63652|34|NZ_CP040819|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 0, identity: 1.0

aggtgatcgggctcagcctctcgggcatcaccgc	CRISPR spacer
aggtgatcgggctcagcctctcgggcatcaccgc	Protospacer
**********************************

10. spacer 3.2|63709|52|NZ_CP040819|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 0, identity: 1.0

tggcgagcctctcctccgccgcgccgcagatggcgggggactacctgctcaa	CRISPR spacer
tggcgagcctctcctccgccgcgccgcagatggcgggggactacctgctcaa	Protospacer
****************************************************

11. spacer 4.1|564387|40|NZ_CP040819|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 0, identity: 1.0

tctcgcccgaaggcgtttcgccggaaggtaccccacaggt	CRISPR spacer
tctcgcccgaaggcgtttcgccggaaggtaccccacaggt	Protospacer
****************************************

12. spacer 5.1|583163|50|NZ_CP040819|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcacggacggcttcggcccgcccgggccgggttcgcgcgttcgggagcc	CRISPR spacer
ggcacggacggcttcggcccgcccgggccgggttcgcgcgttcgggagcc	Protospacer
**************************************************

13. spacer 5.1|583163|50|NZ_CP040819|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcacggacggcttcggcccgcccgggccgggttcgcgcgttcgggagcc	CRISPR spacer
ggcacggacggcttcggcccgcccgggccgggttcgcgcgttcgggagcc	Protospacer
**************************************************

14. spacer 3.1|63652|34|NZ_CP040819|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 9, identity: 0.735

aggtgatcgggctcagcctctcgggcatcaccgc	CRISPR spacer
aggtgatcgggctcagcccgtcggcagtgagcca	Protospacer
******************. ****  .* * *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP040822
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP040818
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040818_1 270637-270812 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040818_2 309868-309978 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040818_3 1912908-1913097 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040818_4 3452776-3452838 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 72896 : 89984 21 Acidithiobacillus_phage(23.08%) terminase,capsid,portal NA
DBSCAN-SWA_2 176923 : 206417 26 Bacillus_virus(33.33%) tail,terminase,portal,tRNA,capsid,head,protease NA
DBSCAN-SWA_3 1433069 : 1502627 57 Catovirus(18.18%) tail,terminase,portal,tRNA,capsid,head NA
DBSCAN-SWA_4 2795399 : 2815440 32 Roseobacter_phage(14.29%) tail,terminase,integrase,portal,head,capsid,protease attL 2790512:2790529|attR 2813610:2813627
DBSCAN-SWA_5 3496339 : 3513621 18 Rhodobacter_phage(30.0%) tail,tRNA,capsid,head,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage