Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP054035 Rhizobium sp. JKLM13E plasmid pPR13E04, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 0 crisprs NA 0 0 24 0
NZ_CP054031 Rhizobium sp. JKLM13E chromosome, complete genome 3 crisprs csa3,cas3,DEDDh,WYL 0 1 7 0
NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP054034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5681 8 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_2 15318 : 23104 6 Ochrobactrum_phage(40.0%) NA NA
DBSCAN-SWA_3 26619 : 27708 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_4 43081 : 43912 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_5 50347 : 51430 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_6 58244 : 59990 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_7 68146 : 77325 9 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_8 83404 : 84889 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 97619 : 109171 10 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_10 115550 : 116630 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_11 121186 : 121972 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_12 126056 : 127589 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_13 132711 : 140309 7 Indivirus(25.0%) NA NA
DBSCAN-SWA_14 146064 : 156911 10 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_15 168992 : 175969 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_16 189604 : 193599 4 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_17 198489 : 199533 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_18 215439 : 217606 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_19 221303 : 222224 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_20 226185 : 227244 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_21 247570 : 252297 5 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_22 264735 : 265524 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_23 269543 : 271094 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_24 278601 : 283208 4 Bacillus_virus(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP054031
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054031_1 829135-829220 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054031_2 1264718-1264860 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054031_3 4538823-4538905 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 104174-104206 3 0.909
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 105276-105308 3 0.909
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 97279-97311 3 0.909
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 763189-763221 3 0.909
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 650622-650654 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 50138-50170 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 34932-34964 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 322318-322350 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 148064-148096 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 486308-486340 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1988932-1988964 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 111280-111312 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 219298-219330 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 322648-322680 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 1146199-1146231 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 205080-205112 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 643872-643904 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 401197-401229 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 88373-88405 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_007764 Rhizobium etli CFN 42 plasmid p42c, complete sequence 232167-232199 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 88557-88589 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 534114-534146 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1586539-1586571 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049248 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence 94647-94679 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 213567-213599 4 0.879
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 339724-339756 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 271201-271233 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 503340-503372 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 287487-287519 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 34941-34973 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 680358-680390 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 115436-115468 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 34946-34978 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 529444-529476 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 521785-521817 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 109151-109183 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 594234-594266 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 475796-475828 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 486570-486602 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 24348-24380 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 837677-837709 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 937176-937208 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 908326-908358 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 328931-328963 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 1284957-1284989 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 2176408-2176440 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 511638-511670 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 322908-322940 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 322908-322940 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 322908-322940 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 322908-322940 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 55712-55744 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1698046-1698078 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 102043-102075 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 485248-485280 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 737331-737363 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 472926-472958 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 648928-648960 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 512002-512034 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 80596-80628 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 348772-348804 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 675696-675728 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 644854-644886 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 662036-662068 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 665437-665469 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 659276-659308 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 662036-662068 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 644854-644886 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 371128-371160 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 641116-641148 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 371122-371154 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 501970-502002 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 179923-179955 5 0.848
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 20980-21012 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 440369-440401 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 26976-27008 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 435236-435268 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 435236-435268 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 435236-435268 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 435236-435268 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1112792-1112824 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 400039-400071 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 430263-430295 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 537958-537990 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 610828-610860 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 331925-331957 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 332295-332327 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 332295-332327 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 332287-332319 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 436307-436339 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 331925-331957 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 411507-411539 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 110885-110917 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 376655-376687 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 307429-307461 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 307428-307460 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 97290-97322 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 5235-5267 6 0.818
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2127671-2127703 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049248 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence 115954-115986 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 1304356-1304388 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 709940-709972 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 11130-11162 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 643242-643274 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 643243-643275 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 641683-641715 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 645930-645962 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 632802-632834 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 643243-643275 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 849422-849454 7 0.788
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 104989-105021 8 0.758
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 417412-417444 9 0.727
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 372852-372884 9 0.727
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 353742-353774 9 0.727
NZ_CP054031_3 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder 4538848-4538880 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 302066-302098 9 0.727

1. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 3, identity: 0.909

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggttttgcgataacgacatgcgcaaaagc	Protospacer
.******************************..

2. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 3, identity: 0.909

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggttttgcgataacgacatgcgcaaaagc	Protospacer
.******************************..

3. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 3, identity: 0.909

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggttttgcgataacgacatgcgcaaaagc	Protospacer
.******************************..

4. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 3, identity: 0.909

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggttttgcgataacgacatgcgtaaaaac	Protospacer
.*************************.*****.

5. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaaac	Protospacer
. ************************.*****.

6. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaaac	Protospacer
. ************************.*****.

7. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaaac	Protospacer
. ************************.*****.

8. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcggaaaaac	Protospacer
. ************************ *****.

9. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
aagcggttttgcgataacgacatgcgtaaaaac	Protospacer
  ************************.*****.

10. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggttttgcgataacgacatgcgcaataac	Protospacer
. *************************** **.

11. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgcaaaaac	Protospacer
. ************.*****************.

12. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
aagcggttttgcgataacgacatgcgtaaaaac	Protospacer
  ************************.*****.

13. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaaac	Protospacer
. ************************.*****.

14. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcggaaaaac	Protospacer
. ************************ *****.

15. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgaaaacgacatgcgcaaaaac	Protospacer
. ************ *****************.

16. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaaac	Protospacer
. ************************.*****.

17. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggttttgcgataccgacatgcgtaaaaac	Protospacer
.*************** *********.*****.

18. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggttttgcgacaacgacatgcgtaaaaac	Protospacer
.*************.***********.*****.

19. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggttttgcgataacgacatgcgtgaaaat	Protospacer
. ************************..*****

20. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_007764 (Rhizobium etli CFN 42 plasmid p42c, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
gcgcggttttgcgataacgacacgcgtaaaaac	Protospacer
 *********************.***.*****.

21. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggttttgcgataacgacatgcgtgaaaat	Protospacer
. ************************..*****

22. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggttttgcgataacgacatgcgtgaaaat	Protospacer
. ************************..*****

23. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ttgcggttttgcgataacgacatacgcaaaatg	Protospacer
*.*********************.*******  

24. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggttttgcgataacgacatgcgggaaaac	Protospacer
.************************* .****.

25. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 4, identity: 0.879

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggttttgcgataacgacatgcgtgaaaat	Protospacer
. ************************..*****

26. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgctaacgacatgcgtaaaaac	Protospacer
. *********** ************.*****.

27. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgagaacgacatgcgtaaaaaa	Protospacer
. ************ ***********.***** 

28. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgctaacgacatgcgtaaaaac	Protospacer
. *********** ************.*****.

29. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgtaaaaac	Protospacer
. ************.***********.*****.

30. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaaca	Protospacer
. ************************.****  

31. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgtaaaaac	Protospacer
. ************.***********.*****.

32. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgctaacgacatgcgtaaaaaa	Protospacer
. *********** ************.***** 

33. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaata	Protospacer
. ************************.****  

34. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcagttttgcgataacgacatgcgtaaaaac	Protospacer
. **.*********************.*****.

35. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaaca	Protospacer
. ************************.****  

36. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgtaaaaca	Protospacer
. ************************.****  

37. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcggtaacgacatgcggaaaact	Protospacer
. ***********.************ **** *

38. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgatgacgacatgcgcaaaacc	Protospacer
. *************.*************** .

39. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgcaaaatg	Protospacer
. ************.****************  

40. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcggaaaaac	Protospacer
. ************.*********** *****.

41. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgcgaaaac	Protospacer
. ************.************.****.

42. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

43. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgcgaaaac	Protospacer
. ************.************.****.

44. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
gagcggttttgcgataaagacatgcgtaaaaac	Protospacer
  *************** ********.*****.

45. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcagttttgcgataacgacatgcgtaaaaac	Protospacer
. **.*********************.*****.

46. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgggataacgacatgcacaaaaac	Protospacer
. ********* *************.******.

47. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggtgttgcgatagcgacatgcgcaaaacc	Protospacer
.****** ********.************** .

48. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
gagcggttttgcgataaagacatgcgtaaaaac	Protospacer
  *************** ********.*****.

49. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
gagcggttttgcgataaagacatgcgtaaaaac	Protospacer
  *************** ********.*****.

50. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
gagcggttttgcgataaagacatgcgtaaaaac	Protospacer
  *************** ********.*****.

51. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
gagcggttttgcgataaagacatgcgtaaaaac	Protospacer
  *************** ********.*****.

52. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacctgcgtaaaaac	Protospacer
. ******************* ****.*****.

53. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgggataacgacatgcacaaaaac	Protospacer
. ********* *************.******.

54. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcggcaacgacatgcgcaaaaac	Protospacer
. ***********..*****************.

55. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggttttgcgacaacgacatgcgtaaaaac	Protospacer
. ************.***********.*****.

56. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacggcatgcgtaaaaac	Protospacer
. *****************.******.*****.

57. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggttttgcgacaacgacatgcgtaaaaac	Protospacer
. ************.***********.*****.

58. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

59. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
atgcggttttgcgataacgacatgtgtaaaaac	Protospacer
 .**********************.*.*****.

60. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgctaacgacatgcgtaaaaac	Protospacer
. *********** ************.*****.

61. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgggataacgacatgcacaaaaac	Protospacer
. ********* *************.******.

62. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

63. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

64. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

65. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

66. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

67. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

68. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

69. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

70. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

71. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaaac	Protospacer
. *************** ********.*****.

72. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggttttgcgacaacgacatgcgtaaaaac	Protospacer
. ************.***********.*****.

73. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.848

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgggataacgacatgcacaaaaac	Protospacer
. ********* *************.******.

74. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
caacggttttgcgctaacgacatgcgtaaaagt	Protospacer
. .********** ************.****.*

75. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

76. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
gagcgattttgcgacaacgacatgcgcaaaaca	Protospacer
  ***.********.****************  

77. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

78. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

79. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

80. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

81. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgaaaagta	Protospacer
. ************************ ***.  

82. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

83. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

84. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgagaacgacatgcgtaaaaca	Protospacer
. ************ ***********.****  

85. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgagaacgacatgcgtaaaaca	Protospacer
. ************ ***********.****  

86. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ctgcggttttgcgataaagacatgcgtaaaagc	Protospacer
..*************** ********.****..

87. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ctgcggttttgcgataaagacatgcgtaaaagc	Protospacer
..*************** ********.****..

88. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ctgcggttttgcgataaagacatgcgtaaaagc	Protospacer
..*************** ********.****..

89. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ctgcggttttgcgataaagacatgcgtaaaagc	Protospacer
..*************** ********.****..

90. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

91. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ctgcggttttgcgataaagacatgcgtaaaagc	Protospacer
..*************** ********.****..

92. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

93. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacggcatgcgaaaaatc	Protospacer
. *****************.****** **** .

94. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataaagacatgcgtaaaagc	Protospacer
. *************** ********.****..

95. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgaaaaatc	Protospacer
. ************.*********** **** .

96. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgaaaaatc	Protospacer
. ************.*********** **** .

97. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcggcaacgacatgcgcaaaacc	Protospacer
. ***********..**************** .

98. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.818

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
caacggttttgcgctaacgacatgcgtaaaaac	Protospacer
. .********** ************.*****.

99. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgataacgacatgcgaaaccta	Protospacer
. ************************ **    

100. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcggtaacgacatgcggtgaaac	Protospacer
. ***********.************  .***.

101. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cccatgttttgcgacaacgacatgcgtaaaaac	Protospacer
.*   *********.***********.*****.

102. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ctgcggttttgcggtaacgacatgcgatcaaac	Protospacer
..***********.************   ***.

103. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggt-tttgcgataacgacatgcgcaaaaat	CRISPR spacer
-tgcggcggttgcgctaacgacatgcgtaaaaac	Protospacer
 .****.  ***** ************.*****.

104. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggt-tttgcgataacgacatgcgcaaaaat	CRISPR spacer
-tgcggcggttgcgctaacgacatgcgtaaaaac	Protospacer
 .****.  ***** ************.*****.

105. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggt-tttgcgataacgacatgcgcaaaaat	CRISPR spacer
-tgcggcggttgcgctaacgacatgcgtaaaaac	Protospacer
 .****.  ***** ************.*****.

106. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggt-tttgcgataacgacatgcgcaaaaat	CRISPR spacer
-tgcggcggttgcgctaacgacatgcgtaaaaac	Protospacer
 .****.  ***** ************.*****.

107. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggt-tttgcgataacgacatgcgcaaaaat	CRISPR spacer
-tgcggcggttgcgctaacgacatgcgtaaaaac	Protospacer
 .****.  ***** ************.*****.

108. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggt-tttgcgataacgacatgcgcaaaaat	CRISPR spacer
-tgcggcggttgcgctaacgacatgcgtaaaaac	Protospacer
 .****.  ***** ************.*****.

109. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggt-tttgcgataacgacatgcgcaaaaat	CRISPR spacer
-tgcggcggttgcgctaacgacatgcgtaaaaac	Protospacer
 .****.  ***** ************.*****.

110. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.788

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgtagattt	Protospacer
. ************.***********.*.*  *

111. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 8, identity: 0.758

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacatgcgctaggga	Protospacer
. ************.************ *... 

112. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.727

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacgacgtgcgtagcaca	Protospacer
. ************.******.****.*. *  

113. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.727

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
ccgcggtttggggataacgacatgcatccagac	Protospacer
.******** * *************..  *.*.

114. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.727

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cggcggtttcgcgatagcgacatgcgtggaacc	Protospacer
. *******.******.*********...** .

115. spacer 3.1|4538848|33|NZ_CP054031|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

tcgcggttttgcgataacgacatgcgcaaaaat	CRISPR spacer
cagcggttttgcgacaacggcatgcgtagattc	Protospacer
. ************.****.******.*.*  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 425217 : 434489 9 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_2 507875 : 518580 7 Bacillus_phage(16.67%) protease NA
DBSCAN-SWA_3 807380 : 820770 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_4 848529 : 939654 98 Planktothrix_phage(14.29%) capsid,head,protease,tRNA,lysis,integrase,terminase,tail,portal attL 896961:896976|attR 912846:912861
DBSCAN-SWA_5 1100595 : 1110849 8 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_6 2147644 : 2157605 7 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_7 3064958 : 3075007 9 Rhodococcus_phage(12.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage