Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040462 Enterococcus sp. M190262 plasmid pM190262, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP040461 Enterococcus sp. M190262 chromosome, complete genome 2 crisprs csa3,cas3,WYL,cas14j,DEDDh,DinG 0 0 4 0

Results visualization

1. NZ_CP040461
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040461_1 631682-631774 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040461_2 2211692-2211795 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1323371 : 1332900 7 Only_Syngen_Nebraska_virus(33.33%) tRNA NA
DBSCAN-SWA_2 1879976 : 1897258 18 Streptococcus_phage(92.31%) NA NA
DBSCAN-SWA_3 2709860 : 2718749 8 Lactobacillus_phage(42.86%) NA NA
DBSCAN-SWA_4 2758707 : 2795307 52 Bacillus_phage(30.0%) holin,terminase,portal,capsid,tail,integrase attL 2765877:2765892|attR 2797728:2797743
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP040462
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040462_1 180750-180846 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040462_1 1.1|180774|49|NZ_CP040462|CRISPRCasFinder 180774-180822 49 NZ_CP040462 Enterococcus sp. M190262 plasmid pM190262, complete sequence 180774-180822 0 1.0

1. spacer 1.1|180774|49|NZ_CP040462|CRISPRCasFinder matches to NZ_CP040462 (Enterococcus sp. M190262 plasmid pM190262, complete sequence) position: , mismatch: 0, identity: 1.0

actttttttcatcattttataaaatgatgaaaaatccccctgaaaacct	CRISPR spacer
actttttttcatcattttataaaatgatgaaaaatccccctgaaaacct	Protospacer
*************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage