Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040319 Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 plasmid p11-0883.1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP040318 Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome 3 crisprs WYL,DinG,cas3,DEDDh,cas14j,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,RT 0 29 10 0
NZ_CP040320 Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 plasmid p11-0883.2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP040319
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14906 : 21494 9 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP040318
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040318_1 2924046-2924155 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040318_2 3125783-3126586 TypeI-E I-E
12 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040318_3 3142718-3145005 TypeI-E I-E
37 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040318_2 2.10|3126358|32|NZ_CP040318|PILER-CR 3126358-3126389 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
NZ_CP040318_2 2.10|3126358|32|NZ_CP040318|PILER-CR 3126358-3126389 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
NZ_CP040318_2 2.16|3126343|32|NZ_CP040318|CRT,CRISPRCasFinder 3126343-3126374 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
NZ_CP040318_2 2.16|3126343|32|NZ_CP040318|CRT,CRISPRCasFinder 3126343-3126374 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
NZ_CP040318_3 3.5|3142991|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3142991-3143022 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
NZ_CP040318_3 3.5|3142991|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3142991-3143022 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
NZ_CP040318_3 3.19|3143847|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143847-3143878 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
NZ_CP040318_3 3.19|3143847|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143847-3143878 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
NZ_CP040318_3 3.11|3143358|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143358-3143389 32 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130783-130814 2 0.938
NZ_CP040318_3 3.18|3143786|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143786-3143817 32 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130783-130814 2 0.938
NZ_CP040318_2 2.10|3126358|32|NZ_CP040318|PILER-CR 3126358-3126389 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
NZ_CP040318_2 2.16|3126343|32|NZ_CP040318|CRT,CRISPRCasFinder 3126343-3126374 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
NZ_CP040318_2 2.7|3126178|28|NZ_CP040318|PILER-CR 3126178-3126205 28 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 337987-338014 5 0.821
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1387347-1387378 5 0.844
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1461559-1461590 5 0.844
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 599340-599371 5 0.844
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 850282-850313 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 887728-887759 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 856045-856076 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 835457-835488 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 953948-953979 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 431895-431926 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 843687-843718 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 833486-833517 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 457962-457993 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1502459-1502490 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1188725-1188756 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1094940-1094971 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 574071-574102 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 758103-758134 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 92938-92969 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1622461-1622492 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 174090-174121 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 996227-996258 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 856529-856560 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1026857-1026888 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 801217-801248 6 0.812
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 887731-887762 6 0.812
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 121315-121346 6 0.812
NZ_CP040318_2 2.6|3126117|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3126117-3126148 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
NZ_CP040318_2 2.6|3126117|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3126117-3126148 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
NZ_CP040318_2 2.6|3126117|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3126117-3126148 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 360377-360408 7 0.781
NZ_CP040318_3 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144274-3144305 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
NZ_CP040318_3 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144274-3144305 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
NZ_CP040318_3 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144274-3144305 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 135155-135186 7 0.781
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 195902-195933 7 0.781
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 581076-581107 7 0.781
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 122557-122588 7 0.781
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 529537-529568 7 0.781
NZ_CP040318_3 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144579-3144610 32 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 327444-327475 7 0.781
NZ_CP040318_2 2.2|3125873|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3125873-3125904 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
NZ_CP040318_2 2.5|3126056|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3126056-3126087 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
NZ_CP040318_2 2.5|3126056|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3126056-3126087 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
NZ_CP040318_3 3.8|3143174|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143174-3143205 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
NZ_CP040318_3 3.8|3143174|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143174-3143205 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 43093-43124 8 0.75
NZ_CP040318_3 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143480-3143511 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 152052-152083 8 0.75
NZ_CP040318_3 3.15|3143602|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143602-3143633 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
NZ_CP040318_3 3.15|3143602|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143602-3143633 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
NZ_CP040318_3 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143969-3144000 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
NZ_CP040318_3 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143969-3144000 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
NZ_CP040318_3 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143969-3144000 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
NZ_CP040318_3 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143969-3144000 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
NZ_CP040318_3 3.33|3144701|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144701-3144732 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
NZ_CP040318_3 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144762-3144793 32 NC_028940 Pectobacterium bacteriophage PM2, complete genome 79087-79118 8 0.75
NZ_CP040318_3 3.10|3143297|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143297-3143328 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
NZ_CP040318_3 3.17|3143725|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143725-3143756 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
NZ_CP040318_3 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143969-3144000 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
NZ_CP040318_3 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143969-3144000 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
NZ_CP040318_3 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3143969-3144000 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
NZ_CP040318_3 3.25|3144213|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144213-3144244 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
NZ_CP040318_3 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144274-3144305 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
NZ_CP040318_3 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144274-3144305 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
NZ_CP040318_3 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144274-3144305 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
NZ_CP040318_3 3.27|3144335|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144335-3144366 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
NZ_CP040318_3 3.27|3144335|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144335-3144366 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
NZ_CP040318_3 3.30|3144518|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144518-3144549 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
NZ_CP040318_3 3.30|3144518|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144518-3144549 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
NZ_CP040318_3 3.30|3144518|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144518-3144549 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
NZ_CP040318_2 2.1|3125812|32|NZ_CP040318|CRISPRCasFinder,CRT 3125812-3125843 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP040318_2 2.1|3125812|32|NZ_CP040318|CRISPRCasFinder,CRT 3125812-3125843 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP040318_2 2.10|3126358|32|NZ_CP040318|PILER-CR 3126358-3126389 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
NZ_CP040318_2 2.16|3126343|32|NZ_CP040318|CRT,CRISPRCasFinder 3126343-3126374 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
NZ_CP040318_3 3.1|3142747|32|NZ_CP040318|CRISPRCasFinder,CRT 3142747-3142778 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
NZ_CP040318_3 3.4|3142930|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3142930-3142961 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
NZ_CP040318_3 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144152-3144183 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
NZ_CP040318_3 3.29|3144457|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144457-3144488 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
NZ_CP040318_3 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144762-3144793 32 NZ_CP042995 Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence 68697-68728 10 0.688
NZ_CP040318_3 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144762-3144793 32 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 43950-43981 10 0.688
NZ_CP040318_3 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144762-3144793 32 NZ_CP038501 Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence 49131-49162 10 0.688
NZ_CP040318_3 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144762-3144793 32 NZ_CP046044 Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence 66631-66662 10 0.688
NZ_CP040318_3 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144762-3144793 32 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 147167-147198 10 0.688
NZ_CP040318_3 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144274-3144305 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
NZ_CP040318_3 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144274-3144305 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656
NZ_CP040318_3 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144945-3144976 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1885546-1885577 11 0.656
NZ_CP040318_3 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144945-3144976 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 56201-56232 11 0.656
NZ_CP040318_3 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144945-3144976 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 83399-83430 11 0.656
NZ_CP040318_3 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144945-3144976 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1487158-1487189 11 0.656
NZ_CP040318_3 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR 3144945-3144976 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 597699-597730 11 0.656

1. spacer 2.10|3126358|32|NZ_CP040318|PILER-CR matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
cggaccgatggggccaacatcgccgaacgtgg	Protospacer
.*******************************

2. spacer 2.10|3126358|32|NZ_CP040318|PILER-CR matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
tggaccgatggggccaacatcgccgaatgtgg	Protospacer
***************************.****

3. spacer 2.16|3126343|32|NZ_CP040318|CRT,CRISPRCasFinder matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
cggaccgatggggccaacatcgccgaacgtgg	Protospacer
.*******************************

4. spacer 2.16|3126343|32|NZ_CP040318|CRT,CRISPRCasFinder matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
tggaccgatggggccaacatcgccgaatgtgg	Protospacer
***************************.****

5. spacer 3.5|3142991|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

tgcgtaatgggctacctgaacttcacatatcc	CRISPR spacer
tgcgtagtgggctacctgaacttcacatatcc	Protospacer
******.*************************

6. spacer 3.5|3142991|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

tgcgtaatgggctacctgaacttcacatatcc	CRISPR spacer
tgcgtagtgggctacctgaacttcacatatcc	Protospacer
******.*************************

7. spacer 3.19|3143847|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

tgcgtaatgggctacctgaacttcacatatcc	CRISPR spacer
tgcgtagtgggctacctgaacttcacatatcc	Protospacer
******.*************************

8. spacer 3.19|3143847|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

tgcgtaatgggctacctgaacttcacatatcc	CRISPR spacer
tgcgtagtgggctacctgaacttcacatatcc	Protospacer
******.*************************

9. spacer 3.11|3143358|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 2, identity: 0.938

accgataaacaaccgcatagcctctttcgttt	CRISPR spacer
accgataaacaatcgcatggcctctttcgttt	Protospacer
************.*****.*************

10. spacer 3.18|3143786|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 2, identity: 0.938

accgataaacaaccgcatagcctctttcgttt	CRISPR spacer
accgataaacaatcgcatggcctctttcgttt	Protospacer
************.*****.*************

11. spacer 2.10|3126358|32|NZ_CP040318|PILER-CR matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
tggacctatggggccaacatcaccgaacgtag	Protospacer
****** **************.********.*

12. spacer 2.16|3126343|32|NZ_CP040318|CRT,CRISPRCasFinder matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
tggacctatggggccaacatcaccgaacgtag	Protospacer
****** **************.********.*

13. spacer 2.7|3126178|28|NZ_CP040318|PILER-CR matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 5, identity: 0.821

gatcgagtaacgtgcgctggaacgcgtc	CRISPR spacer
gattgaggaacgtgcgctggaacgatta	Protospacer
***.*** ****************  * 

14. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

-agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
cagcggc-tatgccccagcggcaccacccgatc	Protospacer
 **** * .*** **** ***************

15. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

-agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
cagcggc-tatgccccagcggcaccacccgatc	Protospacer
 **** * .*** **** ***************

16. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

-agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
cagcggc-tatgccccagcggcaccacccgatc	Protospacer
 **** * .*** **** ***************

17. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

18. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

19. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

20. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

21. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

22. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

23. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

24. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

25. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

26. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

27. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

28. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

29. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

30. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

31. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

32. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

33. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

34. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

35. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

36. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

37. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

38. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

tatttcgc--cttcggcactgacgtcaccgtcaa	CRISPR spacer
--ttccgccgcttcggctccgacgtcaccgtcat	Protospacer
  **.***  ******* *.************* 

39. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812

--agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
ccaacgc--catggccgacccgcaccacccgacc	Protospacer
  *.***  ******* *** ***********.*

40. spacer 2.6|3126117|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

41. spacer 2.6|3126117|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

42. spacer 2.6|3126117|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

43. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 7, identity: 0.781

tatttcgccttcggcactgacgtcaccgtcaa	CRISPR spacer
tacgtcgccttcggcaatgtcgtcaccgaaga	Protospacer
**. ************ ** ********  .*

44. spacer 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

---gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ttcgagc---atgaccggatcggcgctggtgccga	Protospacer
   *.**   **** *************.*****.

45. spacer 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ggcggcggtgaaaggatcggcggtgatgccgg	Protospacer
**  .* .**** ********* *********

46. spacer 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

---gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ttcgagc---atgaccggatcggcgctggtgccga	Protospacer
   *.**   **** *************.*****.

47. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

agcgccacatggcccaccggcaccacccgatc--	CRISPR spacer
gccgccacatggcccaccgccaccagc--gtcgg	Protospacer
. ***************** ***** *  .**  

48. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 7, identity: 0.781

agcgccacatggcccaccggcaccacccgatc--	CRISPR spacer
gccgccacatggcccaccgccaccagc--gtcgg	Protospacer
. ***************** ***** *  .**  

49. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

agcgccacatggcccaccggcaccacc-cgatc	CRISPR spacer
cccgccacatggcccagcggctccatcgccat-	Protospacer
  ************** **** ***.* * ** 

50. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781

agcgccacatggcccaccggcaccacc-cgatc	CRISPR spacer
cccgccacatggcccagcggctccatcgccat-	Protospacer
  ************** **** ***.* * ** 

51. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

agcgccacatggcccaccggcaccacc-cgatc	CRISPR spacer
cccgccacatggcccagcggctccatcgccat-	Protospacer
  ************** **** ***.* * ** 

52. spacer 3.31|3144579|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
agccccacatggcgcaccggcacggcactagc	Protospacer
*** ********* ********* .* * * *

53. spacer 2.2|3125873|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75

gcgaaatagtggggaaaaacccctggttaacc	CRISPR spacer
tttcaatattggggaaaaacccctcgttacct	Protospacer
 .  **** *************** **** *.

54. spacer 2.5|3126056|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

55. spacer 2.5|3126056|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

56. spacer 3.8|3143174|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

taacgaactgaataaaatgtcagaaagtgacg	CRISPR spacer
ggcagaactgaataaaatgtctgatagtgaat	Protospacer
 .  ***************** ** *****  

57. spacer 3.8|3143174|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

taacgaactgaataaaatgtcagaaagtgacg	CRISPR spacer
aaatgaactgaatacaatgtcagacacgcgcg	Protospacer
 **.********** ********* *   .**

58. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tatttcgccttcggcactgacgtcaccgtcaa	CRISPR spacer
tcgaacaccttcgtcacggacgtcaccgtcga	Protospacer
*    *.****** *** ************.*

59. spacer 3.13|3143480|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 8, identity: 0.75

tatttcgccttcggcactgacgtcaccgtcaa	CRISPR spacer
cattgcgccttcggcacggacgtccaccagaa	Protospacer
.*** ************ ******  *   **

60. spacer 3.15|3143602|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

taacgaactgaataaaatgtcagaaagtgacg	CRISPR spacer
ggcagaactgaataaaatgtctgatagtgaat	Protospacer
 .  ***************** ** *****  

61. spacer 3.15|3143602|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

taacgaactgaataaaatgtcagaaagtgacg	CRISPR spacer
aaatgaactgaatacaatgtcagacacgcgcg	Protospacer
 **.********** ********* *   .**

62. spacer 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

-gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
cagcggatcc-ttgccggtatagaccagcgtat	Protospacer
 . ** .*.* ********************  

63. spacer 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gaattttacgttgccggtgtagaccagtgtca	Protospacer
*   . * **********.********.****

64. spacer 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gaattttacgttgccggtgtagaccagtgtca	Protospacer
*   . * **********.********.****

65. spacer 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gatccggacgttgccggtattgaacagcgtcc	Protospacer
* . **  ************ ** ******* 

66. spacer 3.33|3144701|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

taatggccacagtaagtcaaacggttctggaa	CRISPR spacer
cggtggccacagtaaggcacacggttcggcag	Protospacer
...************* ** ******* * *.

67. spacer 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_028940 (Pectobacterium bacteriophage PM2, complete genome) position: , mismatch: 8, identity: 0.75

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
gctctcgtgtgttatatagttatttaatgata	Protospacer
*  ..** * ********************  

68. spacer 3.10|3143297|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tgccagtgactacagaagcgtcgctatcgggg	CRISPR spacer
cacgcctgactaccgaagtgtcgctatcggac	Protospacer
..*   ******* ****.***********. 

69. spacer 3.17|3143725|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tgccagtgactacagaagcgtcgctatcgggg	CRISPR spacer
cacgcctgactaccgaagtgtcgctatcggac	Protospacer
..*   ******* ****.***********. 

70. spacer 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaacttgacgttgccggtatagatcagcgtca	Protospacer
.   .   ***************.********

71. spacer 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaacttgacgttgccggtatagatcagcgtca	Protospacer
.   .   ***************.********

72. spacer 3.21|3143969|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaattttacgttgccggtgtagaccagtgtca	Protospacer
.   . * **********.********.****

73. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
tcctcctggacaggctgaccgttgacgatctg	Protospacer
     **..**** *********** ******

74. spacer 3.25|3144213|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719

accggacaaatcttttttttcctgttcctgtt	CRISPR spacer
gcatcattaatcctttttttcctgttactgta	Protospacer
.*   *. ****.************* **** 

75. spacer 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cagtttgctgaactgctcggcgctgatgccgg	Protospacer
 .*. .  ***** * ****************

76. spacer 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cctgacggtgaaccggtcggcgctgatgccgc	Protospacer
    ** .***** *.*************** 

77. spacer 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cagggcgtcgaactgatcggcgctcatgccgg	Protospacer
 .* .*  .**** ********** *******

78. spacer 3.27|3144335|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******... 

79. spacer 3.27|3144335|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******... 

80. spacer 3.30|3144518|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
gttcagtggacgaggagttcctcacccgcacc	Protospacer
 .   ************** **** ****  *

81. spacer 3.30|3144518|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

82. spacer 3.30|3144518|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

83. spacer 2.1|3125812|32|NZ_CP040318|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

84. spacer 2.1|3125812|32|NZ_CP040318|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

85. spacer 2.10|3126358|32|NZ_CP040318|PILER-CR matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
cacctggatgggggccacatcgccgaacgagt	Protospacer
..  . ******* * ************* * 

86. spacer 2.16|3126343|32|NZ_CP040318|CRT,CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
cacctggatgggggccacatcgccgaacgagt	Protospacer
..  . ******* * ************* * 

87. spacer 3.1|3142747|32|NZ_CP040318|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

atcttcatattgcgtgacgctgccgatgaacg	CRISPR spacer
tgccggatatggcgtgacgatgccgatgatgt	Protospacer
  *.  **** ******** *********   

88. spacer 3.4|3142930|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgcccgttctgcctcttcgcactctcgatcaa	CRISPR spacer
tgcccgttctgtctcttggcactgccaccttc	Protospacer
***********.***** ***** .*. ..  

89. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

90. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

91. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

92. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

93. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

94. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

95. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

96. spacer 3.24|3144152|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

97. spacer 3.29|3144457|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688

gtggtggcctcaaataaattcgagcgctggag	CRISPR spacer
aaacttgcctcaaataaattcgcgcggtgttc	Protospacer
. . * **************** *** **   

98. spacer 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042995 (Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******   

99. spacer 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 10, identity: 0.688

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******   

100. spacer 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038501 (Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******   

101. spacer 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046044 (Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence) position: , mismatch: 10, identity: 0.688

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******   

102. spacer 3.34|3144762|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 10, identity: 0.688

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******   

103. spacer 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
atagactaggagcggatcggcgctgatcggaa	Protospacer
. . **** **.***************   ..

104. spacer 3.26|3144274|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
atagactaggagcggatcggcgctgatcggaa	Protospacer
. . **** **.***************   ..

105. spacer 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 11, identity: 0.656

tgtaaagggtggtctggaaggggatcggcaaa	CRISPR spacer
ccaaaaggttggtctggaaggcgatctcgtcg	Protospacer
.  ***** ************ ****     .

106. spacer 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 11, identity: 0.656

tgtaaagggtggtctggaaggggatcggcaaa	CRISPR spacer
ccaaaaggttggtctggaaggcgatctcgtcg	Protospacer
.  ***** ************ ****     .

107. spacer 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 11, identity: 0.656

tgtaaagggtggtctggaaggggatcggcaaa	CRISPR spacer
ccagaaggttggtctggaaggcgatcgagtcg	Protospacer
.  .**** ************ *****.   .

108. spacer 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 11, identity: 0.656

tgtaaagggtggtctggaaggggatcggcaaa	CRISPR spacer
ccaaaaggttggtctggaaggcgatctcgtcg	Protospacer
.  ***** ************ ****     .

109. spacer 3.37|3144945|32|NZ_CP040318|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 11, identity: 0.656

tgtaaagggtggtctggaaggggatcggcaaa	CRISPR spacer
ccaaaaggttggtctggaaggcgatctcgtcg	Protospacer
.  ***** ************ ****     .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 244946 : 310279 55 uncultured_Mediterranean_phage(10.0%) protease,transposase,plate,tRNA NA
DBSCAN-SWA_2 364924 : 408610 61 Salmonella_phage(90.16%) tail,integrase,terminase,portal,lysis attL 355694:355710|attR 417201:417217
DBSCAN-SWA_3 1016590 : 1025322 7 Dickeya_phage(14.29%) protease,transposase NA
DBSCAN-SWA_4 1075406 : 1174214 102 Salmonella_phage(42.11%) protease,tail,integrase,terminase,portal,holin,lysis,tRNA attL 1078315:1078334|attR 1150102:1150121
DBSCAN-SWA_5 1962891 : 1969700 11 Salmonella_phage(33.33%) integrase,tail attL 1957754:1957776|attR 1967469:1967491
DBSCAN-SWA_6 2045150 : 2123809 103 Salmonella_phage(81.16%) protease,head,tail,integrase,plate,terminase,portal,transposase,holin,capsid attL 2051688:2051703|attR 2125432:2125447
DBSCAN-SWA_7 2269341 : 2341327 73 Cronobacter_phage(54.05%) head,tail,integrase,terminase,portal,holin,capsid,tRNA attL 2270853:2270874|attR 2300860:2300881
DBSCAN-SWA_8 2400626 : 2410932 9 Salmonella_phage(44.44%) holin,tail NA
DBSCAN-SWA_9 2751949 : 2854921 107 Salmonella_phage(33.33%) protease,head,tail,integrase,terminase,portal,transposase,holin,capsid,lysis,tRNA attL 2778805:2778820|attR 2850010:2850025
DBSCAN-SWA_10 4468658 : 4489078 26 Burkholderia_phage(45.0%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage