Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040248 Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP040250 Mycobacterium avium subsp. hominissuis strain 101174 chromosome, complete genome 5 crisprs cas3,csa3,RT,WYL,cas4,DEDDh,DinG 0 3 2 0
NZ_CP040249 Mycobacterium avium subsp. hominissuis strain 101174 plasmid pMARIA, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP040250
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040250_1 626064-626195 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040250_2 853926-854046 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040250_3 2179126-2179369 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040250_4 2508341-2508419 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040250_5 3317614-3317712 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040250_4 4.1|2508368|25|NZ_CP040250|CRISPRCasFinder 2508368-2508392 25 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 34490-34514 4 0.84
NZ_CP040250_4 4.1|2508368|25|NZ_CP040250|CRISPRCasFinder 2508368-2508392 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 481677-481701 4 0.84
NZ_CP040250_4 4.1|2508368|25|NZ_CP040250|CRISPRCasFinder 2508368-2508392 25 NC_031122 Gordonia phage Eyre, complete genome 22215-22239 4 0.84
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 279167-279198 6 0.812
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MF141540 Mycobacterium phage Avocado, complete genome 31893-31924 8 0.75
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MK016494 Mycobacterium phage Filuzino, complete genome 35298-35329 8 0.75
NZ_CP040250_3 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder 2179310-2179344 35 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 620134-620168 8 0.771
NZ_CP040250_3 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder 2179310-2179344 35 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1192931-1192965 8 0.771
NZ_CP040250_3 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder 2179310-2179344 35 MN694530 Marine virus AFVG_250M438, complete genome 7767-7801 8 0.771
NZ_CP040250_3 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder 2179310-2179344 35 MN694240 Marine virus AFVG_250M436, complete genome 8280-8314 8 0.771
NZ_CP040250_3 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder 2179310-2179344 35 MN694170 Marine virus AFVG_250M437, complete genome 30879-30913 8 0.771
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 619056-619087 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 1050461-1050492 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 686591-686622 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 236107-236138 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1603189-1603220 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 619056-619087 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MN369749 Mycobacterium phage MinionDave, complete genome 36157-36188 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MT684597 Mycobacterium phage Mandlovu, complete genome 34776-34807 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MN585973 Mycobacterium phage StAnnes, complete genome 36599-36630 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MT684593 Mycobacterium phage Moonbeam, complete genome 35674-35705 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MN586005 Mycobacterium phage Lorde, complete genome 34870-34901 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NC_048729 Mycobacterium phage Renaud18, complete genome 36966-36997 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MH077580 Mycobacterium phage Melissauren88, complete genome 35620-35651 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MT684595 Mycobacterium phage Mova, complete genome 35440-35471 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NC_011288 Mycobacterium phage Fruitloop, complete genome 37164-37195 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MN369752 Mycobacterium phage Flathead, complete genome 36671-36702 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 KR824843 Mycobacterium phage Ovechkin, complete genome 36001-36032 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MK494118 Mycobacterium phage Cornucopia, complete genome 37451-37482 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MF668270 Mycobacterium phage Emma, complete genome 35718-35749 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 KF114874 Mycobacterium phage Bobi, complete genome 36949-36980 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 KM652553 Mycobacterium phage CaptainTrips, complete genome 35382-35413 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 JN699012 Mycobacterium phage SG4, complete genome 35380-35411 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MN586004 Mycobacterium phage Strokeseat, complete genome 34833-34864 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MN585987 Mycobacterium phage Enby, complete genome 34895-34926 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 MT684601 Mycobacterium phage Hlubikazi, complete genome 34834-34865 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 KT281795 Mycobacterium phage XFactor, complete genome 35328-35359 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NC_025433 Mycobacteriophage Taj, complete genome 36887-36918 9 0.719
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 323951-323982 10 0.688
NZ_CP040250_1 1.1|626089|32|NZ_CP040250|CRISPRCasFinder 626089-626120 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 719994-720025 10 0.688

1. spacer 4.1|2508368|25|NZ_CP040250|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgcgctctgcatcgtcgtggcgcgt	CRISPR spacer
gacgctcttcatcgtcgtggcgcgg	Protospacer
 .****** *************** 

2. spacer 4.1|2508368|25|NZ_CP040250|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgcgctctgcatcgtcgtggcgcgt	CRISPR spacer
cgcgctcttcttcgtcgtggcgcgc	Protospacer
.******* * *************.

3. spacer 4.1|2508368|25|NZ_CP040250|CRISPRCasFinder matches to NC_031122 (Gordonia phage Eyre, complete genome) position: , mismatch: 4, identity: 0.84

tgcgctctgcatcgtcgtggcgcgt	CRISPR spacer
ggcgctctgcatcgtcgtcgcgggc	Protospacer
 ***************** *** *.

4. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

gacgccagagcccgacggtcacgctggc-gtga	CRISPR spacer
gcacccagagccagacggtgacgctggctgtg-	Protospacer
*   ******** ****** ******** *** 

5. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MF141540 (Mycobacterium phage Avocado, complete genome) position: , mismatch: 8, identity: 0.75

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agcgccagagcacgacggacacgctgtggtcg	Protospacer
..********* ****** *******  ** .

6. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MK016494 (Mycobacterium phage Filuzino, complete genome) position: , mismatch: 8, identity: 0.75

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
aattccctagcccgacggtcacgccgccgtgt	Protospacer
.*. **  ****************.* **** 

7. spacer 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.771

gggtggcggcgggtgccggagccgacggcgcagcg	CRISPR spacer
agggcgcggcgggtgccggatccgacggggccgac	Protospacer
.**  *************** ******* ** *  

8. spacer 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.771

gggtggcggcgggtgccggagccgacggcgcagcg	CRISPR spacer
agggcgcggcgggtgccggatccgacggggccgac	Protospacer
.**  *************** ******* ** *  

9. spacer 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder matches to MN694530 (Marine virus AFVG_250M438, complete genome) position: , mismatch: 8, identity: 0.771

gggtggcggcgggtgccggagccga-cggcgcagcg	CRISPR spacer
tggtggcggcgggcggcggagccgacccgctcgac-	Protospacer
 ************.* ********* * ** *..* 

10. spacer 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder matches to MN694240 (Marine virus AFVG_250M436, complete genome) position: , mismatch: 8, identity: 0.771

gggtggcggcgggtgccggagccga-cggcgcagcg	CRISPR spacer
tggtggcggcgggcggcggagccgacccgctcgac-	Protospacer
 ************.* ********* * ** *..* 

11. spacer 3.4|2179310|35|NZ_CP040250|CRISPRCasFinder matches to MN694170 (Marine virus AFVG_250M437, complete genome) position: , mismatch: 8, identity: 0.771

gggtggcggcgggtgccggagccga-cggcgcagcg	CRISPR spacer
tggtggcggcgggcggcggagccgacccgctcgac-	Protospacer
 ************.* ********* * ** *..* 

12. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
aataccagagcccgacggccgcgctggctacc	Protospacer
.*..**************.*.*******    

13. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
aataccagagcccgacggccgcgctggctacc	Protospacer
.*..**************.*.*******    

14. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
aataccagagcccgacggccgcgctggctacc	Protospacer
.*..**************.*.*******    

15. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
aataccagagcccgacggccgcgctggctacc	Protospacer
.*..**************.*.*******    

16. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
aataccagagcccgacggccgcgctggctacc	Protospacer
.*..**************.*.*******    

17. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
aataccagagcccgacggccgcgctggctacc	Protospacer
.*..**************.*.*******    

18. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MN369749 (Mycobacterium phage MinionDave, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

19. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MT684597 (Mycobacterium phage Mandlovu, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

20. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

21. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MT684593 (Mycobacterium phage Moonbeam, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

22. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MN586005 (Mycobacterium phage Lorde, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

23. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
cgttccctagcccgacggtcacgccgccgtgt	Protospacer
 .. **  ****************.* **** 

24. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MH077580 (Mycobacterium phage Melissauren88, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

25. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MT684595 (Mycobacterium phage Mova, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

26. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NC_011288 (Mycobacterium phage Fruitloop, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

27. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MN369752 (Mycobacterium phage Flathead, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
cgttccctagcccgacggtcacgccgccgtgt	Protospacer
 .. **  ****************.* **** 

28. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to KR824843 (Mycobacterium phage Ovechkin, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
cgttccctagcccgacggtcacgccgccgtgt	Protospacer
 .. **  ****************.* **** 

29. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MK494118 (Mycobacterium phage Cornucopia, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

30. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MF668270 (Mycobacterium phage Emma, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

31. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to KF114874 (Mycobacterium phage Bobi, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

32. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to KM652553 (Mycobacterium phage CaptainTrips, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

33. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to JN699012 (Mycobacterium phage SG4, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

34. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MN586004 (Mycobacterium phage Strokeseat, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

35. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MN585987 (Mycobacterium phage Enby, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

36. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to MT684601 (Mycobacterium phage Hlubikazi, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

37. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to KT281795 (Mycobacterium phage XFactor, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
agttccctagcccgacggtcacgccgccgtgt	Protospacer
... **  ****************.* **** 

38. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NC_025433 (Mycobacteriophage Taj, complete genome) position: , mismatch: 9, identity: 0.719

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
cgttccctagcccgacggtcacgccgccgtgt	Protospacer
 .. **  ****************.* **** 

39. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.688

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
cgctggagaacccgacgggcacgctggcgccg	Protospacer
 .*   ***.******** **********. .

40. spacer 1.1|626089|32|NZ_CP040250|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.688

gacgccagagcccgacggtcacgctggcgtga	CRISPR spacer
cgctggagaacccgacgggcacgctggcgccg	Protospacer
 .*   ***.******** **********. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1610556 : 1690873 57 Enterobacteria_phage(20.0%) transposase,tRNA,integrase attL 1637399:1637458|attR 1702152:1702266
DBSCAN-SWA_2 1693950 : 1731208 22 Mycobacterium_phage(55.56%) transposase,integrase attL 1696239:1696256|attR 1708399:1708416
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage