Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP035368 Haemophilus parainfluenzae strain LC_1315_18 chromosome, complete genome 1 crisprs DEDDh,cas14j,DinG,cas3 0 1 3 0

Results visualization

1. NZ_CP035368
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035368_1 722423-722592 TypeV NA
2 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP035368_1 1.1|722461|28|NZ_CP035368|PILER-CR 722461-722488 28 CP031730 Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence 37208-37235 6 0.786

1. spacer 1.1|722461|28|NZ_CP035368|PILER-CR matches to CP031730 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

gcacttttagcggtagcagatatgccgc	CRISPR spacer
gaactttgagcggtagaagatatgcaat	Protospacer
* ***** ******** ******** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 772749 : 834901 81 Mannheimia_phage(44.74%) transposase,tRNA,tail,terminase,lysis,plate,integrase,head,portal,capsid attL 761448:761465|attR 832600:832617
DBSCAN-SWA_2 1267612 : 1275893 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_3 1563910 : 1579232 15 Vibrio_phage(37.5%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage