Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP019192 Streptococcus pneumoniae strain ASP0581 3 crisprs DEDDh,cas3,DinG,RT 0 1 11 0

Results visualization

1. NZ_AP019192
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP019192_1 102502-102597 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP019192_2 1011259-1011362 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP019192_3 1071778-1071857 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP019192_2 2.1|1011292|38|NZ_AP019192|CRISPRCasFinder 1011292-1011329 38 KY065475 Streptococcus phage IPP35, complete genome 23044-23081 4 0.895
NZ_AP019192_2 2.1|1011292|38|NZ_AP019192|CRISPRCasFinder 1011292-1011329 38 MK448453 Streptococcus satellite phage Javan360, complete genome 13985-14022 5 0.868

1. spacer 2.1|1011292|38|NZ_AP019192|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 4, identity: 0.895

ccctttttttctacaataaaataggctccataatatct	CRISPR spacer
gactttttttctacacaaaaataggctccataatatct	Protospacer
  *************  *********************

2. spacer 2.1|1011292|38|NZ_AP019192|CRISPRCasFinder matches to MK448453 (Streptococcus satellite phage Javan360, complete genome) position: , mismatch: 5, identity: 0.868

ccctttttttctacaataaaataggctccataatatct	CRISPR spacer
gactttttttctacaacaaaataggctccataatattc	Protospacer
  **************.*******************..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40295 : 51751 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 84906 : 150052 58 Streptococcus_phage(42.86%) integrase,tRNA,protease,bacteriocin attL 77252:77297|attR 107021:107066
DBSCAN-SWA_3 463616 : 511132 46 Bacillus_phage(22.22%) tRNA,protease,bacteriocin NA
DBSCAN-SWA_4 813983 : 881242 57 Streptococcus_phage(52.63%) bacteriocin,transposase,holin,tRNA,integrase,protease attL 824308:824336|attR 827586:827614
DBSCAN-SWA_5 1068866 : 1092616 22 Streptococcus_phage(89.47%) integrase attL 1077081:1077097|attR 1093607:1093623
DBSCAN-SWA_6 1115590 : 1123595 10 Streptococcus_phage(87.5%) integrase attL 1117360:1117374|attR 1124358:1124372
DBSCAN-SWA_7 1172345 : 1238675 60 Bacillus_phage(17.65%) bacteriocin,holin,transposase,tRNA,protease NA
DBSCAN-SWA_8 1366876 : 1423520 52 Streptococcus_phage(25.0%) holin,tRNA,transposase NA
DBSCAN-SWA_9 1495390 : 1504632 10 Streptococcus_phage(57.14%) protease,transposase NA
DBSCAN-SWA_10 1763821 : 1771153 9 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_11 2134027 : 2142781 9 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage