Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031323 Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031322 Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP031321 Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome 2 crisprs cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,DEDDh,DinG,c2c9_V-U4 0 21 7 0

Results visualization

1. NZ_CP031322
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19891 : 50193 35 Escherichia_phage(42.86%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP031321
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031321_1 838534-839600 TypeI-E I-E
17 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031321_2 865316-866016 Orphan I-E
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031321_1 1.1|838563|32|NZ_CP031321|CRT 838563-838594 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
NZ_CP031321_2 2.5|865589|32|NZ_CP031321|CRISPRCasFinder,CRT 865589-865620 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246757-246788 5 0.844
NZ_CP031321_2 2.16|865590|32|NZ_CP031321|PILER-CR 865590-865621 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246757-246788 5 0.844
NZ_CP031321_1 1.2|838624|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838624-838655 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP031321_1 1.3|838685|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838685-838716 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
NZ_CP031321_1 1.1|838563|32|NZ_CP031321|CRT 838563-838594 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NZ_CP031321_1 1.6|838868|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838868-838899 32 NC_021529 Vibrio phage nt-1, complete genome 92167-92198 7 0.781
NZ_CP031321_1 1.12|839235|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839235-839266 32 NZ_CP038659 Citrobacter freundii strain 680 plasmid p680_1, complete sequence 68441-68472 7 0.781
NZ_CP031321_1 1.12|839235|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839235-839266 32 MN699848 Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence 157559-157590 7 0.781
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4458190-4458221 7 0.781
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4458190-4458221 7 0.781
NZ_CP031321_1 1.1|838563|32|NZ_CP031321|CRT 838563-838594 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NZ_CP031321_1 1.3|838685|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838685-838716 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
NZ_CP031321_1 1.5|838807|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838807-838838 32 NZ_KX893538 Pseudomonas fluorescens strain PC20 plasmid pG20, complete sequence 92280-92311 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_KX426227 Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence 109155-109186 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP033130 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence 307562-307593 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP042557 Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence 123952-123983 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP010351 Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence 219424-219455 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP048828 Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence 163282-163313 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP032285 Acinetobacter sp. WCHA55 plasmid pOXA58_010055, complete sequence 233522-233553 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP042365 Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence 70779-70810 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_MK134375 Acinetobacter baumannii strain 34AB plasmid p34AB, complete sequence 87437-87468 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP038010 Acinetobacter haemolyticus strain TJR01 plasmid pAHTJR1, complete sequence 192432-192463 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP043053 Acinetobacter pittii strain AP43 plasmid pAP43-OXA58-NDM1, complete sequence 122515-122546 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_MH220285 Acinetobacter ursingii strain RIVM0002 plasmid pRIVM0002_IMP-4_171109_B03, complete sequence 298889-298920 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_MH220287 Acinetobacter ursingii strain RIVM0061 plasmid pRIVM0061_IMP-4_171109_B01, complete sequence 295105-295136 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP043309 Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence 287363-287394 8 0.75
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_MH220286 Acinetobacter ursingii strain RIVM0051 plasmid pRIVM0051_IMP-4, complete sequence 239928-239959 8 0.75
NZ_CP031321_1 1.11|839174|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839174-839205 32 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 479551-479582 8 0.75
NZ_CP031321_1 1.15|839418|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839418-839449 32 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 204162-204193 8 0.75
NZ_CP031321_1 1.15|839418|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839418-839449 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 788213-788244 8 0.75
NZ_CP031321_1 1.16|839479|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839479-839510 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 647701-647732 8 0.75
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 475357-475388 8 0.75
NZ_CP031321_2 2.7|865711|32|NZ_CP031321|CRISPRCasFinder,CRT 865711-865742 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 525083-525114 8 0.75
NZ_CP031321_2 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT 865833-865864 32 KY555145 Caulobacter phage Ccr29, complete genome 57425-57456 8 0.75
NZ_CP031321_2 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT 865833-865864 32 KY555143 Caulobacter phage Ccr2, complete genome 52892-52923 8 0.75
NZ_CP031321_2 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT 865833-865864 32 NC_019407 Caulobacter phage CcrMagneto, complete genome 51760-51791 8 0.75
NZ_CP031321_2 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT 865833-865864 32 KY555144 Caulobacter phage Ccr5, complete genome 52344-52375 8 0.75
NZ_CP031321_2 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT 865833-865864 32 KY555142 Caulobacter phage Ccr10, complete genome 52417-52448 8 0.75
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 475357-475388 8 0.75
NZ_CP031321_2 2.18|865712|32|NZ_CP031321|PILER-CR 865712-865743 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 525083-525114 8 0.75
NZ_CP031321_2 2.20|865834|32|NZ_CP031321|PILER-CR 865834-865865 32 KY555145 Caulobacter phage Ccr29, complete genome 57425-57456 8 0.75
NZ_CP031321_2 2.20|865834|32|NZ_CP031321|PILER-CR 865834-865865 32 KY555143 Caulobacter phage Ccr2, complete genome 52892-52923 8 0.75
NZ_CP031321_2 2.20|865834|32|NZ_CP031321|PILER-CR 865834-865865 32 NC_019407 Caulobacter phage CcrMagneto, complete genome 51760-51791 8 0.75
NZ_CP031321_2 2.20|865834|32|NZ_CP031321|PILER-CR 865834-865865 32 KY555144 Caulobacter phage Ccr5, complete genome 52344-52375 8 0.75
NZ_CP031321_2 2.20|865834|32|NZ_CP031321|PILER-CR 865834-865865 32 KY555142 Caulobacter phage Ccr10, complete genome 52417-52448 8 0.75
NZ_CP031321_1 1.1|838563|32|NZ_CP031321|CRT 838563-838594 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
NZ_CP031321_1 1.3|838685|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838685-838716 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
NZ_CP031321_1 1.5|838807|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838807-838838 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 337384-337415 9 0.719
NZ_CP031321_1 1.5|838807|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838807-838838 32 CP027479 Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence 189914-189945 9 0.719
NZ_CP031321_1 1.6|838868|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838868-838899 32 NZ_CP015355 Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence 26849-26880 9 0.719
NZ_CP031321_1 1.14|839357|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839357-839388 32 NZ_CP030832 Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence 41284-41315 9 0.719
NZ_CP031321_1 1.16|839479|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839479-839510 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 208628-208659 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 60391-60422 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 67889-67920 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 126089-126120 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 64063-64094 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 65532-65563 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 84972-85003 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_KX710093 Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence 172763-172794 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_KY271405 Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence 87137-87168 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 5987-6018 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 123116-123147 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 41291-41322 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN783747 Klebsiella oxytoca plasmid pIron_OXY, complete sequence 126581-126612 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 140823-140854 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 55131-55162 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050847 Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence 27384-27415 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 76623-76654 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 145724-145755 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 79543-79574 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 56552-56583 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 113798-113829 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035548 Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence 95465-95496 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052485 Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 156534-156565 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 189207-189238 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_KT347600 Escherichia coli strain EC5207 plasmid pEC5207, complete sequence 146671-146702 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042628 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence 59166-59197 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 109564-109595 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 27485-27516 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 150644-150675 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 158677-158708 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 42890-42921 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 75856-75887 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 42343-42374 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052163 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence 154295-154326 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 268794-268825 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 KY486279 Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence 22960-22991 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 42974-43005 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 2740-2771 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 164476-164507 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP019561 Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence 36106-36137 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 134010-134041 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 34520-34551 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP012256 Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence 24282-24313 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 255983-256014 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 17113-17144 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP030924 Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence 150082-150113 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 108380-108411 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 31842-31873 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 153097-153128 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 62272-62303 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 26409-26440 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 102049-102080 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP044256 Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence 168104-168135 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 89263-89294 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 179787-179818 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 128793-128824 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052159 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 123115-123146 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040652 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence 84052-84083 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 88889-88920 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 127356-127387 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_014107 Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence 27583-27614 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052572 Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP053729 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence 29389-29420 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 169653-169684 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 169636-169667 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 85156-85187 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 75175-75206 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 123752-123783 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 202830-202861 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 112508-112539 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035636 Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence 11554-11585 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP053738 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence 51427-51458 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 184657-184688 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 79961-79992 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP019559 Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence 195888-195919 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP047092 Salmonella sp. S13 plasmid pS13-3, complete sequence 52747-52778 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 211041-211072 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 KX023259 Escherichia coli plasmid pSCE516-4, complete sequence 17135-17166 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026170 Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence 1298-1329 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP051431 Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence 175887-175918 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052144 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 27496-27527 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 125062-125093 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_020261 Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence 15851-15882 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 37537-37568 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024882 Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence 79794-79825 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 108856-108887 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 28466-28497 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP006642 Escherichia coli PCN061 plasmid PCN061p6, complete sequence 18335-18366 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 7282-7313 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 19718-19749 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 135488-135519 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 54076-54107 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 51301-51332 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 51301-51332 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP009871 Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence 12062-12093 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP012682 Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence 33654-33685 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 39224-39255 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 87716-87747 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 78665-78696 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 76683-76714 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 139081-139112 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031547 Escherichia coli strain cq9 plasmid unnamed1, complete sequence 56633-56664 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347226 Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence 55694-55725 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347227 Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence 55586-55617 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347228 Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence 55588-55619 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347229 Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence 55591-55622 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 55686-55717 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347231 Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence 55589-55620 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347232 Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence 55665-55696 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347233 Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence 55670-55701 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347234 Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence 55677-55708 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347235 Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence 55685-55716 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347236 Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence 55672-55703 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 55677-55708 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 55588-55619 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 133570-133601 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024708 Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence 147210-147241 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP034776 Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence 77940-77971 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP042639 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence 145904-145935 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 156655-156686 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP045662 Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence 51803-51834 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 33130-33161 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 178834-178865 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP044301 Escherichia coli strain P59A plasmid pP59A-3, complete sequence 44110-44141 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 10565-10596 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025277 Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence 131995-132026 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP017182 Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence 21421-21452 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP013942 Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence 44399-44430 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 139490-139521 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052357 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 81995-82026 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_LR134257 Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence 33461-33492 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 84060-84091 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 171910-171941 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031569 Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence 128829-128860 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 43617-43648 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 119066-119097 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 18575-18606 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 91698-91729 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052445 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence 26414-26445 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040894 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence 45062-45093 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035380 Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence 104667-104698 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 87695-87726 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 171975-172006 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN310373 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence 21981-22012 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN310374 Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence 108173-108204 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 22250-22281 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 42027-42058 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 75856-75887 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 91344-91375 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MH909331 Leclercia adecarboxylata plasmid p707804-NDM, complete sequence 220327-220358 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 153774-153805 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 139670-139701 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP034251 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence 39196-39227 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035916 Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence 118121-118152 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP039577 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence 89792-89823 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 138188-138219 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 99350-99381 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018818 Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence 10679-10710 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 18575-18606 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 114151-114182 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 10544-10575 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP019019 Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence 69340-69371 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 152482-152513 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 83102-83133 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 21052-21083 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042616 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence 27538-27569 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 59413-59444 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 65278-65309 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 141984-142015 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050011 Citrobacter sp. Y3 plasmid unnamed2, complete sequence 61173-61204 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052559 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052270 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 173018-173049 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 51299-51330 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 265202-265233 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 26245-26276 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 22272-22303 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 81161-81192 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 21479-21510 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 157333-157364 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 76432-76463 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 186405-186436 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 202698-202729 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 200876-200907 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 26887-26918 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 133223-133254 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_008573 Shewanella sp. ANA-3 plasmid unnamed1, complete sequence 181590-181621 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 86557-86588 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052232 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP052873 Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence 17877-17908 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 81477-81508 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040546 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence 74607-74638 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028792 Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence 21871-21902 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 167029-167060 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 139746-139777 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 143194-143225 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 22132-22163 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 157014-157045 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP046273 Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence 23136-23167 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 105327-105358 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 61533-61564 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 8849-8880 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052193 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 34821-34852 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_LT991959 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2 22817-22848 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 LC511658 Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome 135929-135960 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029037 Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence 73977-74008 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 43686-43717 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP043854 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence 72852-72883 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 84059-84090 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 30717-30748 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP039857 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence 83640-83671 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 48003-48034 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 183500-183531 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP036191 Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence 90627-90658 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052561 Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052209 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_006625 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence 102690-102721 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022734 Escherichia coli strain SA186 plasmid pSA186_5, complete sequence 52395-52426 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 23518-23549 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 70555-70586 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 142171-142202 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 215477-215508 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026185 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence 14706-14737 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 141228-141259 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 21694-21725 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 70329-70360 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 134438-134469 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 14591-14622 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP043751 Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence 58583-58614 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 104373-104404 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 70441-70472 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 168396-168427 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 45989-46020 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP019214 Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence 126822-126853 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 197032-197063 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 201327-201358 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 66354-66385 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP043545 Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence 126513-126544 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP012169 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence 23136-23167 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 67389-67420 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 23518-23549 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022149 Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence 33744-33775 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 21870-21901 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP036176 Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence 15823-15854 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052563 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence 26408-26439 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 25094-25125 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 53285-53316 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP030003 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence 27749-27780 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP030066 Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence 151884-151915 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 16894-16925 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 107910-107941 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 171715-171746 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 70308-70339 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 104596-104627 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 118108-118139 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 75618-75649 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP046940 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1 98907-98938 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 69638-69669 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 115196-115227 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 117056-117087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 21057-21088 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP006663 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence 86728-86759 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP009855 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence 100676-100707 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024144 Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence 1276-1307 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 162961-162992 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP008907 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence 58042-58073 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029143 Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence 95049-95080 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 122218-122249 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 102780-102811 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 138430-138461 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 118065-118096 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026058 Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence 57437-57468 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 23481-23512 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 16416-16447 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 19148-19179 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 190390-190421 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 28465-28496 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 102687-102718 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 1080-1111 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 127222-127253 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 159500-159531 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 22121-22152 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 20855-20886 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 176480-176511 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP010154 Escherichia coli strain D9 plasmid B, complete genome 23974-24005 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 80086-80117 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 112528-112559 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 92277-92308 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035906 Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence 25475-25506 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 51727-51758 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 183354-183385 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 119916-119947 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 135628-135659 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024130 Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence 87142-87173 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP034416 Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP011429 Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence 94608-94639 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 195601-195632 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 140936-140967 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 100460-100491 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 22212-22243 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032491 Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence 100943-100974 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032495 Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence 31736-31767 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 111321-111352 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050373 Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence 10677-10708 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 71124-71155 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 289102-289133 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052190 Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 22122-22153 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_005211 Serratia marcescens plasmid R478, complete sequence 129723-129754 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 112875-112906 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 39445-39476 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026661 Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence 140856-140887 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 52604-52635 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 162624-162655 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 115393-115424 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 26426-26457 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 80809-80840 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 158839-158870 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026151 Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence 70847-70878 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 71309-71340 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 97649-97680 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 55592-55623 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 45170-45201 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 191185-191216 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 77431-77462 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 19180-19211 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 27492-27523 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP047678 Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence 107374-107405 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028181 Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence 196311-196342 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032173 Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence 113909-113940 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 31814-31845 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031103 Leclercia sp. W17 plasmid pW17-2, complete sequence 77802-77833 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 124222-124253 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_006671 Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence 71466-71497 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 220520-220551 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP017991 Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence 7287-7318 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 23292-23323 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 16164-16195 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 170227-170258 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021856 Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence 70954-70985 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 18568-18599 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP047676 Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence 107374-107405 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 46823-46854 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 195567-195598 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 70431-70462 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 151909-151940 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 58768-58799 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 134361-134392 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052304 Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052370 Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP051274 Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence 266479-266510 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP033347 Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence 156731-156762 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP011634 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence 8924-8955 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 66623-66654 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042541 Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence 23136-23167 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 87428-87459 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 133462-133493 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 18252-18283 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 113621-113652 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 20785-20816 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 156301-156332 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP051271 Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence 249884-249915 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP052037 Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence 67853-67884 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 11726-11757 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 206031-206062 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 71952-71983 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052204 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 242990-243021 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 116330-116361 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 3964-3995 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP033743 Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence 58619-58650 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 75032-75063 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 74479-74510 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 161423-161454 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP011577 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence 119708-119739 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 248435-248466 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_023025 Cronobacter malonaticus plasmid p2, complete sequence 35571-35602 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP027161 Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence 58429-58460 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 48340-48371 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 171335-171366 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP033798 Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence 8437-8468 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 14571-14602 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035197 Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence 37604-37635 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025009 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence 21105-21136 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 213706-213737 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 132872-132903 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 168159-168190 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052237 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052178 Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence 26414-26445 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 151156-151187 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 15962-15993 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 118268-118299 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 35854-35885 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 25892-25923 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035209 Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence 22132-22163 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024133 Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence 138922-138953 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 24398-24429 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 27763-27794 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041629 Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence 73986-74017 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 141850-141881 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 174325-174356 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 79960-79991 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028543 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP032842 Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence 272825-272856 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP018338 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence 139672-139703 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 185897-185928 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 11439-11470 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026851 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1 81659-81690 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 173287-173318 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 61897-61928 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP054265 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence 140062-140093 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025340 Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence 126485-126516 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 79961-79992 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 138052-138083 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP028781 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 305-336 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 94090-94121 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 121431-121462 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 157146-157177 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 121512-121543 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 14320-14351 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP050784 Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence 137695-137726 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_AP019549 Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence 181676-181707 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052477 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 171594-171625 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 239664-239695 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 79961-79992 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025006 Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence 21103-21134 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 147572-147603 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 160400-160431 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026716 Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence 96498-96529 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP054734 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence 69366-69397 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 79961-79992 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MH884652 Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence 91075-91106 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MH884653 Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence 91388-91419 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 152375-152406 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 229222-229253 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 62005-62036 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 249423-249454 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 27492-27523 9 0.719
NZ_CP031321_2 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT 865467-865498 32 NZ_CP026937 Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence 96658-96689 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_KX015668 Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence 115679-115710 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP033346 Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN076210 plasmid pCFSAN076210, complete sequence 16902-16933 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP010386 Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence 40894-40925 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP030078 Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence 2056-2087 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP029247 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence 2047-2078 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP048417 Citrobacter freundii strain CitB plasmid pA_CitB, complete sequence 2047-2078 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP042573 Enterobacter hormaechei strain E5 plasmid pE5_002, complete sequence 2047-2078 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP027605 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence 48296-48327 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP051133 Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence 19434-19465 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP014995 Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid, complete sequence 66354-66385 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP053193 Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37c, complete sequence 2056-2087 9 0.719
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 72958-72989 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 60391-60422 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 67889-67920 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 126089-126120 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 64063-64094 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 65532-65563 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 84972-85003 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_KX710093 Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence 172763-172794 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_KY271405 Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence 87137-87168 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 5987-6018 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 123116-123147 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 41291-41322 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN783747 Klebsiella oxytoca plasmid pIron_OXY, complete sequence 126581-126612 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 140823-140854 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 55131-55162 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050847 Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence 27384-27415 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 76623-76654 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 145724-145755 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 79543-79574 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 56552-56583 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 113798-113829 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035548 Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence 95465-95496 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052485 Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 156534-156565 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 189207-189238 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_KT347600 Escherichia coli strain EC5207 plasmid pEC5207, complete sequence 146671-146702 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042628 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence 59166-59197 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 109564-109595 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 27485-27516 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 150644-150675 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 158677-158708 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 42890-42921 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 75856-75887 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 42343-42374 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052163 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence 154295-154326 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 268794-268825 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 KY486279 Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence 22960-22991 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 42974-43005 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 2740-2771 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 164476-164507 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP019561 Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence 36106-36137 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 134010-134041 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 34520-34551 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP012256 Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence 24282-24313 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 255983-256014 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 17113-17144 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP030924 Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence 150082-150113 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 108380-108411 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 31842-31873 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 153097-153128 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 62272-62303 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 26409-26440 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 102049-102080 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP044256 Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence 168104-168135 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 89263-89294 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 179787-179818 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 128793-128824 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052159 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 123115-123146 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040652 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence 84052-84083 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 88889-88920 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 127356-127387 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_014107 Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence 27583-27614 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052572 Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP053729 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence 29389-29420 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 169653-169684 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 169636-169667 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 85156-85187 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 75175-75206 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 123752-123783 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 202830-202861 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 112508-112539 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035636 Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence 11554-11585 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP053738 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence 51427-51458 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 184657-184688 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 79961-79992 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP019559 Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence 195888-195919 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP047092 Salmonella sp. S13 plasmid pS13-3, complete sequence 52747-52778 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 211041-211072 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 KX023259 Escherichia coli plasmid pSCE516-4, complete sequence 17135-17166 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026170 Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence 1298-1329 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP051431 Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence 175887-175918 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052144 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 27496-27527 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 125062-125093 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_020261 Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence 15851-15882 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 37537-37568 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024882 Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence 79794-79825 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 108856-108887 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 28466-28497 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP006642 Escherichia coli PCN061 plasmid PCN061p6, complete sequence 18335-18366 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 7282-7313 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 19718-19749 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 135488-135519 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 54076-54107 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 51301-51332 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 51301-51332 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP009871 Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence 12062-12093 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP012682 Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence 33654-33685 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 39224-39255 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 87716-87747 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 78665-78696 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 76683-76714 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 139081-139112 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031547 Escherichia coli strain cq9 plasmid unnamed1, complete sequence 56633-56664 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347226 Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence 55694-55725 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347227 Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence 55586-55617 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347228 Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence 55588-55619 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347229 Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence 55591-55622 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 55686-55717 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347231 Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence 55589-55620 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347232 Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence 55665-55696 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347233 Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence 55670-55701 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347234 Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence 55677-55708 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347235 Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence 55685-55716 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347236 Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence 55672-55703 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 55677-55708 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 55588-55619 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 133570-133601 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024708 Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence 147210-147241 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP034776 Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence 77940-77971 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP042639 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence 145904-145935 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 156655-156686 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP045662 Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence 51803-51834 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 33130-33161 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 178834-178865 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP044301 Escherichia coli strain P59A plasmid pP59A-3, complete sequence 44110-44141 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 10565-10596 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025277 Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence 131995-132026 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP017182 Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence 21421-21452 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP013942 Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence 44399-44430 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 139490-139521 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052357 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 81995-82026 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_LR134257 Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence 33461-33492 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 84060-84091 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 171910-171941 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031569 Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence 128829-128860 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 43617-43648 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 119066-119097 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 18575-18606 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 91698-91729 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052445 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence 26414-26445 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040894 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence 45062-45093 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035380 Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence 104667-104698 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 87695-87726 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 171975-172006 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN310373 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence 21981-22012 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN310374 Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence 108173-108204 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 22250-22281 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 42027-42058 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 75856-75887 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 91344-91375 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MH909331 Leclercia adecarboxylata plasmid p707804-NDM, complete sequence 220327-220358 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 153774-153805 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 139670-139701 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP034251 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence 39196-39227 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035916 Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence 118121-118152 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP039577 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence 89792-89823 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 138188-138219 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 99350-99381 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018818 Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence 10679-10710 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 18575-18606 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 114151-114182 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 10544-10575 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP019019 Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence 69340-69371 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 152482-152513 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 83102-83133 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 21052-21083 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042616 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence 27538-27569 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 59413-59444 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 65278-65309 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 141984-142015 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050011 Citrobacter sp. Y3 plasmid unnamed2, complete sequence 61173-61204 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052559 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052270 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 173018-173049 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 51299-51330 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 265202-265233 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 26245-26276 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 22272-22303 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 81161-81192 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 21479-21510 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 157333-157364 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 76432-76463 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 186405-186436 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 202698-202729 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 200876-200907 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 26887-26918 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 133223-133254 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_008573 Shewanella sp. ANA-3 plasmid unnamed1, complete sequence 181590-181621 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 86557-86588 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052232 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP052873 Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence 17877-17908 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 81477-81508 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040546 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence 74607-74638 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028792 Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence 21871-21902 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 167029-167060 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 139746-139777 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 143194-143225 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 22132-22163 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 157014-157045 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP046273 Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence 23136-23167 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 105327-105358 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 61533-61564 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 8849-8880 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052193 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 34821-34852 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_LT991959 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2 22817-22848 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 LC511658 Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome 135929-135960 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029037 Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence 73977-74008 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 43686-43717 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP043854 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence 72852-72883 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 84059-84090 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 30717-30748 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP039857 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence 83640-83671 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 48003-48034 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 183500-183531 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP036191 Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence 90627-90658 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052561 Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052209 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_006625 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence 102690-102721 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022734 Escherichia coli strain SA186 plasmid pSA186_5, complete sequence 52395-52426 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 23518-23549 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 70555-70586 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 142171-142202 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 215477-215508 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026185 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence 14706-14737 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 141228-141259 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 21694-21725 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 70329-70360 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 134438-134469 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 14591-14622 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP043751 Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence 58583-58614 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 104373-104404 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 70441-70472 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 168396-168427 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 45989-46020 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP019214 Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence 126822-126853 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 197032-197063 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 201327-201358 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 66354-66385 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP043545 Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence 126513-126544 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP012169 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence 23136-23167 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 67389-67420 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 23518-23549 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022149 Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence 33744-33775 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 21870-21901 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP036176 Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence 15823-15854 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052563 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence 26408-26439 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 25094-25125 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 53285-53316 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP030003 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence 27749-27780 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP030066 Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence 151884-151915 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 16894-16925 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 107910-107941 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 171715-171746 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 70308-70339 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 104596-104627 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 118108-118139 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 75618-75649 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP046940 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1 98907-98938 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 69638-69669 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 115196-115227 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 117056-117087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 21057-21088 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP006663 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence 86728-86759 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP009855 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence 100676-100707 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024144 Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence 1276-1307 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 162961-162992 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP008907 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence 58042-58073 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029143 Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence 95049-95080 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 122218-122249 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 102780-102811 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 138430-138461 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 118065-118096 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026058 Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence 57437-57468 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 23481-23512 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 16416-16447 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 19148-19179 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 190390-190421 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 28465-28496 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 102687-102718 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 1080-1111 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 127222-127253 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 159500-159531 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 22121-22152 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 20855-20886 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 176480-176511 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP010154 Escherichia coli strain D9 plasmid B, complete genome 23974-24005 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 80086-80117 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 112528-112559 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 92277-92308 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035906 Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence 25475-25506 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 51727-51758 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 183354-183385 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 119916-119947 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 135628-135659 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024130 Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence 87142-87173 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP034416 Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP011429 Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence 94608-94639 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 195601-195632 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 140936-140967 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 100460-100491 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 22212-22243 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032491 Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence 100943-100974 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032495 Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence 31736-31767 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 111321-111352 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050373 Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence 10677-10708 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 71124-71155 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 289102-289133 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052190 Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 22122-22153 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_005211 Serratia marcescens plasmid R478, complete sequence 129723-129754 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 112875-112906 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 39445-39476 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026661 Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence 140856-140887 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 52604-52635 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 162624-162655 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 115393-115424 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 26426-26457 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 80809-80840 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 158839-158870 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026151 Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence 70847-70878 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 71309-71340 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 97649-97680 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 55592-55623 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 45170-45201 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 191185-191216 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 77431-77462 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 19180-19211 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 27492-27523 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP047678 Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence 107374-107405 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028181 Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence 196311-196342 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032173 Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence 113909-113940 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 31814-31845 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031103 Leclercia sp. W17 plasmid pW17-2, complete sequence 77802-77833 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 124222-124253 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_006671 Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence 71466-71497 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 220520-220551 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP017991 Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence 7287-7318 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 23292-23323 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 16164-16195 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 170227-170258 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021856 Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence 70954-70985 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 18568-18599 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP047676 Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence 107374-107405 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 46823-46854 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 195567-195598 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 70431-70462 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 151909-151940 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 58768-58799 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 134361-134392 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052304 Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052370 Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP051274 Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence 266479-266510 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP033347 Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence 156731-156762 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP011634 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence 8924-8955 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 66623-66654 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042541 Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence 23136-23167 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 87428-87459 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 133462-133493 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 18252-18283 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 113621-113652 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 20785-20816 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 156301-156332 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP051271 Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence 249884-249915 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP052037 Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence 67853-67884 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 11726-11757 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 206031-206062 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 71952-71983 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052204 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence 26413-26444 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 242990-243021 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 116330-116361 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 3964-3995 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP033743 Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence 58619-58650 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 75032-75063 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 74479-74510 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 161423-161454 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP011577 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence 119708-119739 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 248435-248466 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_023025 Cronobacter malonaticus plasmid p2, complete sequence 35571-35602 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP027161 Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence 58429-58460 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 48340-48371 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 171335-171366 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP033798 Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence 8437-8468 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 14571-14602 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035197 Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence 37604-37635 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025009 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence 21105-21136 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 213706-213737 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 132872-132903 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 168159-168190 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052237 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052178 Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence 26414-26445 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 151156-151187 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 15962-15993 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 118268-118299 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 35854-35885 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 25892-25923 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035209 Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence 22132-22163 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024133 Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence 138922-138953 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 24398-24429 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 27763-27794 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041629 Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence 73986-74017 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 141850-141881 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 174325-174356 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 79960-79991 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028543 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP032842 Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence 272825-272856 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP018338 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence 139672-139703 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 185897-185928 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 11439-11470 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 26420-26451 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026851 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1 81659-81690 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 173287-173318 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 61897-61928 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP054265 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence 140062-140093 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025340 Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence 126485-126516 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 79961-79992 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 138052-138083 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP028781 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 305-336 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 94090-94121 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 121431-121462 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 157146-157177 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 121512-121543 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 14320-14351 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP050784 Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence 137695-137726 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_AP019549 Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence 181676-181707 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052477 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence 21055-21086 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 171594-171625 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 239664-239695 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 79961-79992 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025006 Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence 21103-21134 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 147572-147603 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 160400-160431 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026716 Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence 96498-96529 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 21056-21087 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP054734 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence 69366-69397 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 79961-79992 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MH884652 Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence 91075-91106 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MH884653 Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence 91388-91419 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 152375-152406 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 229222-229253 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 62005-62036 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 249423-249454 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 27492-27523 9 0.719
NZ_CP031321_2 2.14|865468|32|NZ_CP031321|PILER-CR 865468-865499 32 NZ_CP026937 Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence 96658-96689 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_KX015668 Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence 115679-115710 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP033346 Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN076210 plasmid pCFSAN076210, complete sequence 16902-16933 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP010386 Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence 40894-40925 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP030078 Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence 2056-2087 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP029247 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence 2047-2078 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP048417 Citrobacter freundii strain CitB plasmid pA_CitB, complete sequence 2047-2078 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP042573 Enterobacter hormaechei strain E5 plasmid pE5_002, complete sequence 2047-2078 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP027605 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence 48296-48327 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP051133 Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence 19434-19465 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP014995 Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid, complete sequence 66354-66385 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP053193 Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37c, complete sequence 2056-2087 9 0.719
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 72958-72989 9 0.719
NZ_CP031321_1 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839051-839082 32 NZ_CP009059 Borreliella afzelii K78 plasmid lp54, complete sequence 24694-24725 10 0.688
NZ_CP031321_1 1.14|839357|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839357-839388 32 NC_021909 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence 532459-532490 10 0.688
NZ_CP031321_1 1.16|839479|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839479-839510 32 NZ_CP011667 Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence 178017-178048 10 0.688
NZ_CP031321_1 1.16|839479|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839479-839510 32 MN224564 Streptomyces phage Araceli, complete genome 8348-8379 10 0.688
NZ_CP031321_2 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT 865528-865559 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1979379-1979410 10 0.688
NZ_CP031321_2 2.15|865529|32|NZ_CP031321|PILER-CR 865529-865560 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1979379-1979410 10 0.688
NZ_CP031321_1 1.5|838807|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 838807-838838 32 NZ_AP014639 Leptolyngbya boryana IAM M-101 plasmid pLBA 74288-74319 11 0.656
NZ_CP031321_1 1.11|839174|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839174-839205 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1386734-1386765 11 0.656
NZ_CP031321_1 1.11|839174|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder 839174-839205 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 745636-745667 11 0.656
NZ_CP031321_2 2.7|865711|32|NZ_CP031321|CRISPRCasFinder,CRT 865711-865742 32 NZ_CP029988 Sphingomonas sp. FARSPH plasmid p03, complete sequence 9902-9933 11 0.656
NZ_CP031321_2 2.18|865712|32|NZ_CP031321|PILER-CR 865712-865743 32 NZ_CP029988 Sphingomonas sp. FARSPH plasmid p03, complete sequence 9902-9933 11 0.656

1. spacer 1.1|838563|32|NZ_CP031321|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

2. spacer 2.5|865589|32|NZ_CP031321|CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 5, identity: 0.844

tgtttttctgccggtttaacacggtgcgataa	CRISPR spacer
tgtttttctgccggattaacgcggtgcgagtg	Protospacer
************** *****.********  .

3. spacer 2.16|865590|32|NZ_CP031321|PILER-CR matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 5, identity: 0.844

tgtttttctgccggtttaacacggtgcgataa	CRISPR spacer
tgtttttctgccggattaacgcggtgcgagtg	Protospacer
************** *****.********  .

4. spacer 1.2|838624|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

5. spacer 1.3|838685|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgggcgtaccgcatcgcggacaacaagctga	Protospacer
.** ******** **************..** 

6. spacer 1.1|838563|32|NZ_CP031321|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

7. spacer 1.6|838868|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 7, identity: 0.781

ggcaacataacgaacaaaatcaacgtcaacct	CRISPR spacer
gtcaacataatgagcaaaatcaacgtctctgt	Protospacer
* ********.**.*************  . *

8. spacer 1.12|839235|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038659 (Citrobacter freundii strain 680 plasmid p680_1, complete sequence) position: , mismatch: 7, identity: 0.781

acttgcgagatatttagcgtgttcggcatcga	CRISPR spacer
aattatcaaatatttagcgtgttaagcatcga	Protospacer
* **.. *.************** .*******

9. spacer 1.12|839235|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to MN699848 (Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence) position: , mismatch: 7, identity: 0.781

acttgcgagatatttagcgtgttcggcatcga	CRISPR spacer
aattatcaaatatttagcgtgttaagcatcga	Protospacer
* **.. *.************** .*******

10. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aggagaacgtgatccgcaacgtcgaaggcgtt	Protospacer
*.** .************* *********.. 

11. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aggagaacgtgatccgcaacgtcgaaggcgtt	Protospacer
*.** .************* *********.. 

12. spacer 1.1|838563|32|NZ_CP031321|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

13. spacer 1.3|838685|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgcgcctaccggatcgcggacaaccgcacgg	Protospacer
.***** ****************** .  .* 

14. spacer 1.5|838807|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX893538 (Pseudomonas fluorescens strain PC20 plasmid pG20, complete sequence) position: , mismatch: 8, identity: 0.75

gctggttttgaatcgtcccgcgctcgagacgc	CRISPR spacer
actggttttgaatcggccggcgctgtaatcgt	Protospacer
.************** ** *****  *. **.

15. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX426227 (Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

16. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033130 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

17. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042557 (Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

18. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010351 (Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

19. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

20. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032285 (Acinetobacter sp. WCHA55 plasmid pOXA58_010055, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

21. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042365 (Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

22. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK134375 (Acinetobacter baumannii strain 34AB plasmid p34AB, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

23. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038010 (Acinetobacter haemolyticus strain TJR01 plasmid pAHTJR1, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

24. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043053 (Acinetobacter pittii strain AP43 plasmid pAP43-OXA58-NDM1, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

25. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH220285 (Acinetobacter ursingii strain RIVM0002 plasmid pRIVM0002_IMP-4_171109_B03, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

26. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH220287 (Acinetobacter ursingii strain RIVM0061 plasmid pRIVM0061_IMP-4_171109_B01, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

27. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043309 (Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

28. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH220286 (Acinetobacter ursingii strain RIVM0051 plasmid pRIVM0051_IMP-4, complete sequence) position: , mismatch: 8, identity: 0.75

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
attattttaagttaaaatgattttaaattttt	Protospacer
. * ** .***.* ***************** 

29. spacer 1.11|839174|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.75

ggagcgggaaggtcagaccgtcaacaacgcac	CRISPR spacer
cgatcgggaaggtcagaccgtcgacttccggc	Protospacer
 ** ******************.**  *  .*

30. spacer 1.15|839418|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 8, identity: 0.75

atcatt--cgcacacccccgcgtaaatgctggaa	CRISPR spacer
--cgatggcgaacagccccgcgtaaatgctgaga	Protospacer
  *. *  ** *** ****************..*

31. spacer 1.15|839418|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75

atcatt--cgcacacccccgcgtaaatgctggaa	CRISPR spacer
--cgatggcgaacagccccgcgtaaatgctgaga	Protospacer
  *. *  ** *** ****************..*

32. spacer 1.16|839479|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 8, identity: 0.75

-gcgaccacgcagagcggcgacaacctgacgtt	CRISPR spacer
cttgatc-cgcagagcggcgacaacccggcggc	Protospacer
  .**.* ******************.*.** .

33. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.75

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
cggacgacgtgatcggcaaagtcgaccaggcg	Protospacer
 .************ **********  . .**

34. spacer 2.7|865711|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.75

aaacgggaccagtgctgcgatagcctggaggg	CRISPR spacer
cgtcaggaccggtgctgcgatagcctggccga	Protospacer
 . *.*****.*****************  *.

35. spacer 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

36. spacer 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

37. spacer 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

38. spacer 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

39. spacer 2.9|865833|32|NZ_CP031321|CRISPRCasFinder,CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

40. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.75

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
cggacgacgtgatcggcaaagtcgaccaggcg	Protospacer
 .************ **********  . .**

41. spacer 2.18|865712|32|NZ_CP031321|PILER-CR matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.75

aaacgggaccagtgctgcgatagcctggaggg	CRISPR spacer
cgtcaggaccggtgctgcgatagcctggccga	Protospacer
 . *.*****.*****************  *.

42. spacer 2.20|865834|32|NZ_CP031321|PILER-CR matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

43. spacer 2.20|865834|32|NZ_CP031321|PILER-CR matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

44. spacer 2.20|865834|32|NZ_CP031321|PILER-CR matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

45. spacer 2.20|865834|32|NZ_CP031321|PILER-CR matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

46. spacer 2.20|865834|32|NZ_CP031321|PILER-CR matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.75

tatccagt-acccgccagcgggtttactgacgg	CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg	Protospacer
 *.  *.. ************* **.*******

47. spacer 1.1|838563|32|NZ_CP031321|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

48. spacer 1.3|838685|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719

acgcgcgtaccggatcgcggacaacaaattgc------	CRISPR spacer
tcgcgcggaccggatcgcggccaa------gccccgcg	Protospacer
 ****** ************ ***      **      

49. spacer 1.5|838807|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

gctggttttgaatcgtcccgcgctcgagacgc	CRISPR spacer
actggttttgaatcggccggcgctgtgatcgt	Protospacer
.************** ** *****  .. **.

50. spacer 1.5|838807|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gctggttttgaatcgtcccgcgctcgagacgc	CRISPR spacer
actggttttgaatcggccggcgctgtgatcgt	Protospacer
.************** ** *****  .. **.

51. spacer 1.6|838868|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015355 (Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence) position: , mismatch: 9, identity: 0.719

ggcaacataacgaacaaaatcaacgtcaacct	CRISPR spacer
tgcaacagaaccaacaaaatcaacattatatc	Protospacer
 ****** *** ************.*.*  ..

52. spacer 1.14|839357|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 9, identity: 0.719

ctgtgaaaagaacggctcaatagcgcgaccgg	CRISPR spacer
ggtcgagaagaacggctcaattgcgcgagcaa	Protospacer
   .**.************** ****** *..

53. spacer 1.16|839479|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

gcgaccacgcagagcggcgacaacctgacgtt	CRISPR spacer
accgtcgcgcagatcggcgacgacctgacgcc	Protospacer
.* ..*.****** *******.********..

54. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

55. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

56. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

57. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

58. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

59. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

60. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

61. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

62. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

63. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

64. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

65. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

66. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

67. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

68. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

69. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

70. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

71. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

72. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

73. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

74. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

75. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

76. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

77. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

78. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

79. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

80. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

81. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

82. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

83. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

84. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

85. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

86. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

87. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

88. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

89. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

90. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

91. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

92. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

93. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

94. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

95. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

96. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

97. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP012256 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

98. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

99. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

100. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

101. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

102. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

103. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

104. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

105. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

106. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

107. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

108. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

109. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

110. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

111. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

112. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

113. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

114. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

115. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

116. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040652 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

117. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

118. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

119. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

120. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

121. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

122. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

123. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

124. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

125. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

126. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

127. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

128. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

129. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

130. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

131. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

132. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

133. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

134. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

135. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

136. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

137. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

138. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

139. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

140. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

141. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

142. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

143. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

144. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

145. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

146. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

147. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

148. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_020261 (Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

149. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

150. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

151. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

152. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

153. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP006642 (Escherichia coli PCN061 plasmid PCN061p6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

154. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

155. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

156. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

157. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

158. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

159. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

160. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

161. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

162. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

163. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

164. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

165. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

166. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

167. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

168. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

169. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

170. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

171. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

172. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

173. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

174. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

175. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

176. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

177. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

178. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

179. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

180. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

181. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

182. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

183. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

184. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

185. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

186. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

187. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

188. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

189. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

190. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

191. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

192. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

193. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

194. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

195. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

196. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

197. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

198. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

199. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

200. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

201. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

202. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

203. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

204. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

205. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

206. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

207. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

208. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

209. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

210. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

211. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

212. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

213. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

214. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

215. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

216. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

217. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

218. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

219. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

220. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

221. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

222. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

223. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

224. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

225. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

226. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

227. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

228. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

229. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

230. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

231. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

232. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

233. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

234. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

235. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

236. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

237. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

238. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

239. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

240. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

241. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

242. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

243. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

244. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

245. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

246. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

247. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

248. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

249. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

250. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

251. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

252. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

253. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

254. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

255. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

256. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

257. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

258. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

259. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

260. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

261. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

262. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

263. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

264. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

265. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

266. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

267. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

268. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

269. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

270. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

271. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

272. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

273. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

274. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

275. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

276. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

277. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

278. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

279. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

280. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

281. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

282. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_LT991959 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

283. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

284. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

285. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

286. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

287. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

288. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

289. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

290. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

291. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

292. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

293. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

294. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

295. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

296. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

297. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

298. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

299. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

300. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

301. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

302. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

303. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

304. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026185 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

305. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

306. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

307. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

308. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

309. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

310. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

311. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

312. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

313. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

314. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

315. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

316. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

317. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

318. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

319. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

320. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

321. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

322. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

323. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

324. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

325. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

326. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

327. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

328. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

329. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

330. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

331. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

332. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

333. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

334. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

335. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

336. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

337. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

338. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

339. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

340. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

341. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

342. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

343. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

344. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

345. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

346. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

347. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

348. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

349. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

350. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

351. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

352. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

353. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

354. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

355. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

356. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

357. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

358. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

359. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

360. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

361. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

362. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

363. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

364. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

365. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

366. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

367. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

368. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

369. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

370. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

371. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

372. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

373. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

374. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

375. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

376. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

377. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

378. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

379. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

380. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

381. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

382. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

383. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

384. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

385. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

386. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

387. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

388. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

389. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

390. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

391. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

392. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

393. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

394. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

395. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

396. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

397. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

398. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

399. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

400. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

401. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

402. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

403. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

404. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

405. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

406. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

407. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

408. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

409. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

410. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

411. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

412. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

413. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

414. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

415. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

416. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

417. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

418. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

419. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

420. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

421. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

422. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

423. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

424. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

425. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

426. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

427. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

428. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

429. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

430. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

431. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

432. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

433. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

434. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

435. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

436. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

437. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

438. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

439. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

440. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

441. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

442. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

443. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

444. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

445. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

446. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

447. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

448. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

449. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

450. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

451. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

452. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

453. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

454. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

455. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

456. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

457. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

458. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

459. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

460. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

461. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

462. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

463. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

464. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

465. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

466. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

467. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

468. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

469. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

470. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

471. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

472. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

473. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

474. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

475. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

476. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

477. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

478. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

479. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

480. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

481. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

482. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

483. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

484. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

485. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP033798 (Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

486. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

487. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035197 (Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

488. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

489. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

490. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

491. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

492. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

493. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

494. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

495. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

496. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

497. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

498. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

499. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

500. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

501. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

502. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024133 (Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

503. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

504. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

505. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

506. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

507. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

508. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

509. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

510. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

511. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

512. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

513. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

514. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

515. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

516. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

517. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

518. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

519. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

520. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

521. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

522. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

523. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

524. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

525. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

526. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

527. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

528. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

529. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

530. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

531. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

532. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

533. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

534. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

535. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

536. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

537. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

538. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

539. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

540. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

541. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

542. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

543. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

544. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

545. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

546. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

547. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

548. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

549. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

550. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

551. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

552. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

553. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

554. spacer 2.3|865467|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

555. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_KX015668 (Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

556. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP033346 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN076210 plasmid pCFSAN076210, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

557. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP010386 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

558. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP030078 (Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

559. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029247 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

560. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP048417 (Citrobacter freundii strain CitB plasmid pA_CitB, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

561. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP042573 (Enterobacter hormaechei strain E5 plasmid pE5_002, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

562. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP027605 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

563. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP051133 (Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

564. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP014995 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

565. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP053193 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37c, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

566. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aagacggcgtgatccgcgaagtccggctcgct	Protospacer
******.**********.***** ..  *.* 

567. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

568. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

569. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

570. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

571. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

572. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

573. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

574. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

575. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

576. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

577. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

578. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

579. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

580. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

581. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

582. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

583. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

584. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

585. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

586. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

587. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

588. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

589. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

590. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

591. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

592. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

593. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

594. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

595. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

596. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

597. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

598. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

599. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

600. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

601. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

602. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

603. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

604. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

605. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

606. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

607. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

608. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

609. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

610. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP012256 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

611. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

612. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

613. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

614. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

615. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

616. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

617. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

618. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

619. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

620. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

621. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

622. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

623. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

624. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

625. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

626. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

627. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

628. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

629. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040652 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

630. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

631. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

632. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

633. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

634. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

635. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

636. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

637. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

638. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

639. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

640. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

641. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

642. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

643. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

644. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

645. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

646. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

647. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

648. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

649. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

650. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

651. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

652. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

653. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

654. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

655. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

656. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

657. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

658. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

659. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

660. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

661. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_020261 (Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

662. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

663. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

664. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

665. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

666. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP006642 (Escherichia coli PCN061 plasmid PCN061p6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

667. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

668. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

669. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

670. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

671. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

672. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

673. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

674. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

675. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

676. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

677. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

678. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

679. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

680. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

681. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

682. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

683. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

684. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

685. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

686. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

687. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

688. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

689. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

690. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

691. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

692. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

693. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

694. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

695. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

696. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

697. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

698. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

699. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

700. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

701. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

702. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

703. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

704. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

705. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

706. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

707. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

708. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

709. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

710. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

711. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

712. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

713. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

714. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

715. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

716. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

717. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

718. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

719. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

720. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

721. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

722. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

723. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

724. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

725. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

726. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

727. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

728. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

729. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

730. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

731. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

732. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

733. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

734. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

735. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

736. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

737. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

738. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

739. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

740. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

741. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

742. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

743. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

744. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

745. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

746. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

747. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

748. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

749. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

750. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

751. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

752. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

753. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

754. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

755. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

756. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

757. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

758. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

759. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

760. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

761. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

762. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

763. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

764. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

765. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

766. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

767. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

768. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

769. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

770. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

771. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

772. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

773. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

774. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

775. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

776. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

777. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

778. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

779. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

780. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

781. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

782. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

783. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

784. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

785. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

786. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

787. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

788. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

789. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

790. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

791. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

792. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

793. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

794. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

795. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_LT991959 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

796. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

797. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

798. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

799. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

800. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

801. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

802. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

803. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

804. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

805. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

806. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

807. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

808. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

809. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

810. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

811. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

812. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

813. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

814. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

815. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

816. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

817. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026185 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

818. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

819. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

820. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

821. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

822. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

823. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

824. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

825. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

826. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

827. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

828. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

829. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

830. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

831. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

832. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

833. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

834. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

835. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

836. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

837. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

838. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

839. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

840. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

841. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

842. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

843. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

844. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

845. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

846. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

847. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

848. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

849. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

850. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

851. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

852. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

853. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

854. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

855. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

856. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

857. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

858. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

859. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

860. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

861. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

862. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

863. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

864. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

865. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

866. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

867. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

868. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

869. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

870. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

871. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

872. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

873. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

874. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

875. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

876. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

877. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

878. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

879. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

880. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

881. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

882. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

883. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

884. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

885. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

886. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

887. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

888. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

889. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

890. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

891. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

892. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

893. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

894. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

895. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

896. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

897. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

898. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

899. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

900. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

901. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

902. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

903. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

904. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

905. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

906. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

907. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

908. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

909. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

910. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

911. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

912. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

913. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

914. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

915. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

916. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

917. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

918. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

919. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

920. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

921. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

922. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

923. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

924. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

925. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

926. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

927. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

928. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

929. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

930. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

931. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

932. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

933. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

934. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

935. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

936. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

937. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

938. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

939. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

940. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

941. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

942. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

943. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

944. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

945. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

946. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

947. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

948. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

949. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

950. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

951. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

952. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

953. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

954. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

955. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

956. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

957. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

958. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

959. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

960. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

961. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

962. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

963. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

964. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

965. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

966. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

967. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

968. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

969. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

970. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

971. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

972. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

973. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

974. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

975. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

976. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

977. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

978. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

979. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

980. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

981. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

982. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

983. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

984. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

985. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

986. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

987. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

988. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

989. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

990. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

991. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

992. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

993. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

994. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

995. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

996. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

997. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

998. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP033798 (Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

999. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1000. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035197 (Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1001. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1002. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1003. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1004. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1005. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1006. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1007. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1008. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1009. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1010. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1011. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1012. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1013. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1014. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1015. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024133 (Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1016. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1017. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1018. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1019. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1020. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1021. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1022. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1023. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1024. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1025. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1026. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1027. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1028. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1029. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1030. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1031. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1032. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1033. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1034. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1035. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1036. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1037. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1038. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1039. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1040. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1041. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1042. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1043. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1044. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1045. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1046. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1047. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1048. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1049. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1050. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1051. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1052. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1053. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1054. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1055. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1056. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1057. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1058. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1059. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1060. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1061. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1062. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1063. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1064. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1065. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1066. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1067. spacer 2.14|865468|32|NZ_CP031321|PILER-CR matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcacgataacgctgctgtgattcgtccccgt	CRISPR spacer
atcaagataacgctgctgtgactcaagttgct	Protospacer
**** ****************.**.  ..  *

1068. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_KX015668 (Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1069. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP033346 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN076210 plasmid pCFSAN076210, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1070. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP010386 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1071. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP030078 (Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1072. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP029247 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1073. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP048417 (Citrobacter freundii strain CitB plasmid pA_CitB, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1074. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP042573 (Enterobacter hormaechei strain E5 plasmid pE5_002, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1075. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP027605 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1076. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP051133 (Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1077. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP014995 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1078. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP053193 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37c, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc	Protospacer
**.**************** ****  .. .* 

1079. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
aagacggcgtgatccgcgaagtccggctcgct	Protospacer
******.**********.***** ..  *.* 

1080. spacer 1.9|839051|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009059 (Borreliella afzelii K78 plasmid lp54, complete sequence) position: , mismatch: 10, identity: 0.688

ggttttacaagcttaaatgattttaaattttg	CRISPR spacer
acctttagaagattaaatgattttaaaaaaat	Protospacer
. .**** *** ***************     

1081. spacer 1.14|839357|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 10, identity: 0.688

ctgtgaaaagaacggctcaatagcgcgaccgg	CRISPR spacer
tatttcgcagaccggatcaatagcgcgaccga	Protospacer
.  *  . *** *** ***************.

1082. spacer 1.16|839479|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 10, identity: 0.688

gcgaccacgcagagcggcgacaacctgacgtt	CRISPR spacer
atcaccccgcagagcggcgacgacctcttcgt	Protospacer
.. *** **************.****  .  *

1083. spacer 1.16|839479|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to MN224564 (Streptomyces phage Araceli, complete genome) position: , mismatch: 10, identity: 0.688

gcgaccacgcagagcggcgacaacctgacgtt	CRISPR spacer
aagaccacgcagacgggcgacaaccccaacaa	Protospacer
. ***********  **********. *    

1084. spacer 2.4|865528|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
ggctcgacgtgatcggcaaaggcgaagacggc	Protospacer
..  ********** ****** *****.*.  

1085. spacer 2.15|865529|32|NZ_CP031321|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688

aagacgacgtgatccgcaaagtcgaaggcacg	CRISPR spacer
ggctcgacgtgatcggcaaaggcgaagacggc	Protospacer
..  ********** ****** *****.*.  

1086. spacer 1.5|838807|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP014639 (Leptolyngbya boryana IAM M-101 plasmid pLBA) position: , mismatch: 11, identity: 0.656

gctggttttgaatcgtcccgcgctcgagacgc	CRISPR spacer
caatgttttgactcgccccgcgctcgaagaag	Protospacer
    ******* ***.***********.. . 

1087. spacer 1.11|839174|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

ggagcgggaaggtcagaccgtcaacaacgcac	CRISPR spacer
cattcggcaaggtcagaccgccaacaagatca	Protospacer
 .  *** ************.****** ..  

1088. spacer 1.11|839174|32|NZ_CP031321|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 11, identity: 0.656

ggagcgggaaggtcagaccgtcaacaacgcac	CRISPR spacer
cattcggcaaggtcagaccgccaacaagatca	Protospacer
 .  *** ************.****** ..  

1089. spacer 2.7|865711|32|NZ_CP031321|CRISPRCasFinder,CRT matches to NZ_CP029988 (Sphingomonas sp. FARSPH plasmid p03, complete sequence) position: , mismatch: 11, identity: 0.656

aaacgggaccagtgctgcgatagcctggaggg	CRISPR spacer
tgcttcctccagtactgcgatcgcctggagga	Protospacer
 . .    *****.******* *********.

1090. spacer 2.18|865712|32|NZ_CP031321|PILER-CR matches to NZ_CP029988 (Sphingomonas sp. FARSPH plasmid p03, complete sequence) position: , mismatch: 11, identity: 0.656

aaacgggaccagtgctgcgatagcctggaggg	CRISPR spacer
tgcttcctccagtactgcgatcgcctggagga	Protospacer
 . .    *****.******* *********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 149196 : 213141 67 Escherichia_phage(45.45%) capsid,tail,integrase,portal,lysis,head,plate,tRNA,holin,terminase attL 154254:154281|attR 185872:185899
DBSCAN-SWA_2 225652 : 235093 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 815099 : 822239 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_4 1854826 : 1861327 8 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_5 2965947 : 2972726 8 Enterobacteria_phage(100.0%) integrase attL 2964078:2964091|attR 2976153:2976166
DBSCAN-SWA_6 3243246 : 3303391 71 Enterobacteria_phage(51.79%) capsid,tail,integrase,portal,lysis,transposase,head,tRNA,protease,terminase attL 3253408:3253454|attR 3303815:3303861
DBSCAN-SWA_7 4021333 : 4084567 68 Enterobacteria_phage(33.33%) capsid,tail,integrase,portal,head,plate,protease,holin,terminase attL 4013828:4013841|attR 4023841:4023854
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage