Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP030347 Enterobacter hormaechei strain AR_038 chromosome, complete genome 3 crisprs csa3,DEDDh,cas3,WYL,DinG 0 2 13 0
NZ_CP030349 Enterobacter hormaechei strain AR_038 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP030350 Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP030348 Enterobacter hormaechei strain AR_038 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 0 crisprs RT 0 0 2 0
NZ_CP030346 Enterobacter hormaechei strain AR_038 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP030347
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030347_1 3048220-3048381 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030347_2 3402388-3402490 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030347_3 4250348-4250436 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 JF974302 Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces 21037-21067 6 0.806
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592513 Vibrio phage 1.142.O._10N.261.49.E11, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592412 Vibrio phage 1.028.O._10N.286.45.B6, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592527 Vibrio phage 1.159.O._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592588 Vibrio phage 1.217.O._10N.261.45.A1, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592589 Vibrio phage 1.219.O._10N.261.45.E2, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592524 Vibrio phage 1.156.O._10N.261.45.A6, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592669 Vibrio phage 2.159.A._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592670 Vibrio phage 2.159.B._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 MG592507 Vibrio phage 1.136.O._10N.261.45.E11, partial genome 26631-26661 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1534665-1534695 7 0.774
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 62534-62564 8 0.742
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 283146-283176 8 0.742
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 22328-22358 9 0.71
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 475099-475129 9 0.71
NZ_CP030347_3 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder 4250377-4250407 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 714186-714216 10 0.677
NZ_CP030347_1 1.1|3048272|58|NZ_CP030347|CRISPRCasFinder 3048272-3048329 58 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 15954-16011 12 0.793

1. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to JF974302 (Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces) position: , mismatch: 6, identity: 0.806

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
acaatgctctggcgcgtttcagtgtcgccgt	Protospacer
* **..* ********* **.**********

2. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592513 (Vibrio phage 1.142.O._10N.261.49.E11, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

3. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592412 (Vibrio phage 1.028.O._10N.286.45.B6, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

4. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592527 (Vibrio phage 1.159.O._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

5. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592588 (Vibrio phage 1.217.O._10N.261.45.A1, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

6. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592589 (Vibrio phage 1.219.O._10N.261.45.E2, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

7. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592524 (Vibrio phage 1.156.O._10N.261.45.A6, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

8. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592669 (Vibrio phage 2.159.A._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

9. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592670 (Vibrio phage 2.159.B._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

10. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to MG592507 (Vibrio phage 1.136.O._10N.261.45.E11, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

11. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aaaacacg----ctggcgcgtgtcggtgtcgccgt	CRISPR spacer
----cccggcacctggcgcgtgacggtctcgccgt	Protospacer
    * **    ********** **** *******

12. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.742

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
tgagatcgcgggcgagtgtcggtgtcgccgc	Protospacer
 .*.  *** **** ***************.

13. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.742

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
tagaactgctggcgcgtgtcggcatcgccga	Protospacer
 *.*  .***************..****** 

14. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
atcctgggctgccgcgtgtcgatgtcgccgg	Protospacer
*   .. **** *********.******** 

15. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.71

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
atcctgggctgccgggtgtcggtgtcgccgg	Protospacer
*   .. **** ** *************** 

16. spacer 3.1|4250377|31|NZ_CP030347|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.677

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
ctgcggcgctggcgcgggtcggagtcgcccc	Protospacer
  .  .********** ***** ****** .

17. spacer 1.1|3048272|58|NZ_CP030347|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 12, identity: 0.793

gaaacgataaaaagccgggtggcggctacgccttacccggcctacatgttctacatat	CRISPR spacer
tcgcaaataaaaagccgggtggcggctacgccttacccggcctacatcgtctgcttga	Protospacer
  .  .*****************************************  ***.* *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 210670 : 218175 10 Enterobacteria_phage(85.71%) integrase attL 202242:202256|attR 218827:218841
DBSCAN-SWA_2 332198 : 379980 38 Vibrio_phage(25.0%) protease,transposase,tRNA NA
DBSCAN-SWA_3 560476 : 606419 60 Enterobacteria_phage(21.43%) portal,integrase,terminase,holin,protease,plate,tRNA,tail attL 556007:556022|attR 585177:585192
DBSCAN-SWA_4 830539 : 839113 10 Enterobacteria_phage(100.0%) integrase attL 815803:815816|attR 832489:832502
DBSCAN-SWA_5 1247875 : 1275186 22 uncultured_virus(25.0%) transposase NA
DBSCAN-SWA_6 1678897 : 1721738 53 Salmonella_phage(76.74%) head,portal,integrase,lysis,terminase,capsid,plate,tRNA,tail attL 1673422:1673441|attR 1728756:1728775
DBSCAN-SWA_7 2327307 : 2371855 54 Salmonella_phage(37.25%) holin,tail,terminase,integrase attL 2319498:2319513|attR 2354338:2354353
DBSCAN-SWA_8 2459964 : 2560153 104 Enterobacterial_phage(23.21%) head,portal,integrase,terminase,holin,capsid,protease,tRNA,tail attL 2451385:2451400|attR 2502064:2502079
DBSCAN-SWA_9 3368689 : 3375161 6 Enterobacterial_phage(33.33%) NA NA
DBSCAN-SWA_10 3379588 : 3435197 67 Enterobacteria_phage(47.73%) coat,head,portal,integrase,lysis,terminase,capsid,protease,tRNA,tail attL 3398557:3398572|attR 3417392:3417407
DBSCAN-SWA_11 3469619 : 3573760 139 Cronobacter_phage(19.0%) head,portal,integrase,lysis,terminase,holin,protease,plate,tail attL 3538977:3538993|attR 3579235:3579251
DBSCAN-SWA_12 3657195 : 3668008 9 Bodo_saltans_virus(12.5%) NA NA
DBSCAN-SWA_13 3927985 : 3991134 77 Enterobacterial_phage(28.3%) head,portal,integrase,terminase,holin,capsid,protease,tRNA,tail attL 3922333:3922347|attR 3990512:3990526
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP030345
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6742 : 52221 50 Escherichia_phage(26.32%) protease,integrase,transposase attL 4462:4475|attR 49826:49839
DBSCAN-SWA_2 62091 : 106761 40 Escherichia_phage(27.78%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP030350
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 54093 : 61115 10 Escherichia_phage(33.33%) integrase attL 49607:49620|attR 70390:70403
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage