Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028434 Escherichia coli strain RM9975 plasmid pRM9975-2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP028433 Escherichia coli strain RM9975 plasmid pRM9975-1, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP028432 Escherichia coli strain RM9975 chromosome, complete genome 2 crisprs DinG,PrimPol,cas3,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas14i 0 5 17 0

Results visualization

1. NZ_CP028434
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2288 : 65955 56 Escherichia_phage(21.43%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028432
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028432_1 3299566-3299899 TypeI-E I-E
5 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028432_2 3325601-3325995 Unclear I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028432_1 1.1|3299595|32|NZ_CP028432|CRT 3299595-3299626 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
NZ_CP028432_1 1.2|3299656|32|NZ_CP028432|CRT,PILER-CR,CRISPRCasFinder 3299656-3299687 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP028432_1 1.1|3299595|32|NZ_CP028432|CRT 3299595-3299626 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NZ_CP028432_1 1.1|3299595|32|NZ_CP028432|CRT 3299595-3299626 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NZ_CP028432_2 2.1|3325630|32|NZ_CP028432|CRISPRCasFinder 3325630-3325661 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP028432_1 1.1|3299595|32|NZ_CP028432|CRT 3299595-3299626 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
NZ_CP028432_1 1.3|3299717|32|NZ_CP028432|CRT,PILER-CR,CRISPRCasFinder 3299717-3299748 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
NZ_CP028432_1 1.4|3299778|32|NZ_CP028432|CRT,PILER-CR,CRISPRCasFinder 3299778-3299809 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
NZ_CP028432_1 1.4|3299778|32|NZ_CP028432|CRT,PILER-CR,CRISPRCasFinder 3299778-3299809 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719

1. spacer 1.1|3299595|32|NZ_CP028432|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

2. spacer 1.2|3299656|32|NZ_CP028432|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

3. spacer 1.1|3299595|32|NZ_CP028432|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

4. spacer 1.1|3299595|32|NZ_CP028432|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

5. spacer 2.1|3325630|32|NZ_CP028432|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

6. spacer 1.1|3299595|32|NZ_CP028432|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

7. spacer 1.3|3299717|32|NZ_CP028432|CRT,PILER-CR,CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ . 

8. spacer 1.4|3299778|32|NZ_CP028432|CRT,PILER-CR,CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc	Protospacer
.   ****************.* **** .** 

9. spacer 1.4|3299778|32|NZ_CP028432|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc	Protospacer
.   ****.************* **** .** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 326305 : 336633 10 Enterobacteria_phage(22.22%) integrase,transposase attL 319897:319910|attR 333960:333973
DBSCAN-SWA_2 550431 : 630323 69 Escherichia_phage(33.33%) tRNA,capsid,head,protease,tail,transposase NA
DBSCAN-SWA_3 849748 : 869073 28 Enterobacteria_phage(52.17%) holin,tail,integrase,transposase attL 849661:849675|attR 870400:870414
DBSCAN-SWA_4 1079727 : 1122286 54 Escherichia_phage(38.46%) protease,holin,transposase NA
DBSCAN-SWA_5 1177822 : 1245071 58 Escherichia_phage(23.53%) protease,integrase,transposase attL 1170059:1170073|attR 1201285:1201299
DBSCAN-SWA_6 1345862 : 1410547 69 Stx2-converting_phage(40.82%) transposase,tRNA,capsid,holin,head,integrase,tail,terminase attL 1340956:1340970|attR 1347437:1347451
DBSCAN-SWA_7 1511763 : 1584785 78 Enterobacteria_phage(43.14%) transposase,portal,holin,protease,tail,terminase NA
DBSCAN-SWA_8 1645169 : 1740929 114 Escherichia_phage(42.53%) transposase,tRNA,capsid,holin,head,integrase,tail,terminase attL 1703878:1703937|attR 1734622:1735933
DBSCAN-SWA_9 1880151 : 2004089 119 Stx2-converting_phage(39.62%) terminase,capsid,portal,holin,head,integrase,protease,tail,lysis,transposase attL 1961658:1961674|attR 1999319:1999335
DBSCAN-SWA_10 2127570 : 2165654 45 Enterobacteria_phage(86.11%) transposase,plate,tRNA,capsid,portal,holin,head,tail,terminase NA
DBSCAN-SWA_11 2385277 : 2476306 106 Enterobacteria_phage(33.33%) terminase,capsid,portal,holin,head,integrase,tail,transposase attL 2385236:2385295|attR 2481898:2483211
DBSCAN-SWA_12 2701366 : 2770264 64 Enterobacteria_phage(20.0%) terminase,capsid,holin,integrase,protease,lysis,transposase attL 2739306:2739341|attR 2771204:2771239
DBSCAN-SWA_13 3119984 : 3204609 86 Enterobacteria_phage(68.52%) terminase,tRNA,portal,integrase,protease,tail,transposase attL 3187966:3187981|attR 3211413:3211428
DBSCAN-SWA_14 3276137 : 3283277 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_15 3532379 : 3588355 50 Escherichia_phage(40.0%) protease,transposase,tRNA NA
DBSCAN-SWA_16 4828555 : 4863546 33 Stx2-converting_phage(48.28%) tRNA,capsid,holin,head,tail,terminase NA
DBSCAN-SWA_17 4947134 : 4993669 37 Escherichia_phage(25.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP028433
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 119510 123 Salmonella_phage(81.31%) portal,integrase,tail,tRNA,terminase,transposase attL 1102:1161|attR 52781:54092
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage