Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP030080 Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence 0 crisprs csa3,RT 0 0 3 0
NZ_CP030077 Enterobacter hormaechei strain 20710 plasmid p3-20710, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP030078 Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence 1 crisprs DEDDh 0 1 1 0
NZ_CP030079 Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence 0 crisprs cas14j 0 0 1 0
NZ_CP030076 Enterobacter hormaechei strain 20710 chromosome, complete genome 1 crisprs csa3,DinG,WYL,DEDDh,cas3 0 0 364 0
NZ_CP030081 Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence 1 crisprs DEDDh 0 2 2 0

Results visualization

1. NZ_CP030079
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3436 : 46373 53 Escherichia_phage(27.78%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP030077
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 30574 : 57241 26 Salmonella_phage(27.27%) integrase,transposase attL 40376:40390|attR 52279:52293
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP030078
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030078_1 40166-40255 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP030078_1 1.1|40190|42|NZ_CP030078|CRISPRCasFinder 40190-40231 42 NZ_CP030078 Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence 40190-40231 0 1.0
NZ_CP030078_1 1.1|40190|42|NZ_CP030078|CRISPRCasFinder 40190-40231 42 NZ_CP029247 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence 40170-40211 0 1.0
NZ_CP030078_1 1.1|40190|42|NZ_CP030078|CRISPRCasFinder 40190-40231 42 NZ_KX015668 Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence 69193-69234 0 1.0

1. spacer 1.1|40190|42|NZ_CP030078|CRISPRCasFinder matches to NZ_CP030078 (Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence) position: , mismatch: 0, identity: 1.0

gactctgcttttgtataagcctgtccagctggggtatagctc	CRISPR spacer
gactctgcttttgtataagcctgtccagctggggtatagctc	Protospacer
******************************************

2. spacer 1.1|40190|42|NZ_CP030078|CRISPRCasFinder matches to NZ_CP029247 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence) position: , mismatch: 0, identity: 1.0

gactctgcttttgtataagcctgtccagctggggtatagctc	CRISPR spacer
gactctgcttttgtataagcctgtccagctggggtatagctc	Protospacer
******************************************

3. spacer 1.1|40190|42|NZ_CP030078|CRISPRCasFinder matches to NZ_KX015668 (Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence) position: , mismatch: 0, identity: 1.0

gactctgcttttgtataagcctgtccagctggggtatagctc	CRISPR spacer
gactctgcttttgtataagcctgtccagctggggtatagctc	Protospacer
******************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 107614 119 Salmonella_phage(94.55%) tail,terminase,integrase attL 1067:1089|attR 108237:108259
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP030080
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 69555 : 111910 48 Acinetobacter_phage(22.22%) transposase,protease,integrase attL 95705:95764|attR 116687:117975
DBSCAN-SWA_2 115464 : 174982 49 Salmonella_phage(54.55%) transposase,protease NA
DBSCAN-SWA_3 237379 : 269701 36 uncultured_Caudovirales_phage(42.86%) transposase,integrase attL 267220:267233|attR 272442:272455
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP030076
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030076_1 3871677-3871781 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14433 18 Bacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_2 17515 : 18886 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_3 24662 : 34775 10 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_4 39554 : 39812 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_5 52056 : 53699 2 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_6 56976 : 58102 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_7 72364 : 73318 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_8 88418 : 88664 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_9 93267 : 94194 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_10 101855 : 102392 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_11 106543 : 107377 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_12 114418 : 115207 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_13 131821 : 134978 4 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_14 143203 : 147844 4 uncultured_Caudovirales_phage(66.67%) protease NA
DBSCAN-SWA_15 152074 : 154129 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_16 166618 : 171855 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_17 177290 : 183803 4 Bacillus_virus(25.0%) tRNA NA
DBSCAN-SWA_18 202664 : 207212 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_19 211388 : 212477 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_20 216534 : 246284 22 Tetraselmis_virus(14.29%) tRNA,protease NA
DBSCAN-SWA_21 263116 : 265819 1 Orgyia_leucostigma_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_22 282224 : 282953 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_23 286073 : 297293 12 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_24 303650 : 305745 3 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_25 311753 : 313804 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_26 321289 : 323161 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_27 326376 : 330503 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_28 338078 : 339674 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_29 344997 : 345366 1 Campylobacter_virus(100.0%) NA NA
DBSCAN-SWA_30 353677 : 358817 6 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_31 362345 : 362999 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_32 370210 : 377474 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_33 387092 : 388001 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_34 395225 : 398644 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_35 406912 : 413441 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_36 417764 : 421234 4 Edwardsiella_phage(33.33%) NA NA
DBSCAN-SWA_37 449887 : 450679 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_38 453775 : 460139 5 Hokovirus(50.0%) NA NA
DBSCAN-SWA_39 463411 : 464089 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_40 475656 : 479443 2 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_41 484050 : 485715 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_42 489641 : 490688 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_43 496518 : 497244 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_44 500844 : 503427 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_45 509818 : 512275 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_46 517065 : 517878 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_47 537982 : 544346 5 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_48 553720 : 558137 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_49 570066 : 574781 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_50 581055 : 589324 7 Brazilian_cedratvirus(33.33%) holin NA
DBSCAN-SWA_51 593804 : 595332 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_52 610452 : 613161 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_53 621254 : 621542 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_54 625541 : 626513 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_55 636897 : 637287 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_56 641550 : 680562 67 Erwinia_phage(43.64%) integrase,terminase,capsid,plate attL 636728:636774|attR 680576:680622
DBSCAN-SWA_57 690170 : 691037 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_58 694775 : 696161 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_59 704268 : 704955 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_60 708087 : 708759 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_61 711789 : 714288 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_62 724265 : 729810 5 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_63 736579 : 743633 6 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_64 746672 : 750936 2 Herpes_simplex_virus(50.0%) NA NA
DBSCAN-SWA_65 758084 : 761613 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_66 765991 : 767357 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_67 770513 : 775561 4 Sodalis_phage(25.0%) protease NA
DBSCAN-SWA_68 796439 : 798101 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_69 801712 : 806052 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_70 817869 : 826856 6 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_71 830463 : 831567 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_72 839480 : 840641 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_73 849154 : 849922 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_74 854769 : 856554 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_75 860767 : 916198 83 Escherichia_phage(43.28%) holin,coat,tail,integrase,lysis,transposase,terminase attL 863907:863952|attR 912285:912330
DBSCAN-SWA_76 929401 : 929980 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_77 935739 : 937989 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_78 947235 : 947943 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_79 957715 : 961588 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_80 981525 : 985730 5 Bradyrhizobium_phage(33.33%) NA NA
DBSCAN-SWA_81 989786 : 990590 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_82 997256 : 998288 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_83 1010252 : 1014370 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_84 1023196 : 1023955 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_85 1035313 : 1036747 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_86 1040682 : 1041027 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_87 1046933 : 1047731 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_88 1052899 : 1059673 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_89 1072244 : 1078785 5 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_90 1087026 : 1088451 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_91 1099391 : 1099955 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_92 1104146 : 1105190 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_93 1131141 : 1132866 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_94 1145651 : 1146353 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_95 1152626 : 1158018 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_96 1165656 : 1167024 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_97 1176560 : 1177709 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_98 1181208 : 1195036 11 Megavirus(20.0%) tRNA NA
DBSCAN-SWA_99 1208436 : 1215699 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_100 1224646 : 1225969 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_101 1231428 : 1234227 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_102 1237965 : 1239030 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_103 1246294 : 1247574 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_104 1251305 : 1252970 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_105 1292121 : 1299234 3 Bacillus_virus(50.0%) protease NA
DBSCAN-SWA_106 1305019 : 1307925 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_107 1320875 : 1322171 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_108 1329780 : 1332243 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_109 1337053 : 1344699 6 Liberibacter_phage(33.33%) integrase attL 1323586:1323599|attR 1346052:1346065
DBSCAN-SWA_110 1363071 : 1373248 7 Paramecium_bursaria_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_111 1378455 : 1381199 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_112 1394609 : 1402766 7 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_113 1419375 : 1421025 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_114 1437031 : 1438963 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_115 1442938 : 1455924 11 Lactococcus_phage(20.0%) tRNA,protease NA
DBSCAN-SWA_116 1459840 : 1460386 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_117 1467669 : 1468647 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_118 1474592 : 1475123 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_119 1481413 : 1483394 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_120 1500231 : 1501734 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_121 1508250 : 1509039 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_122 1514589 : 1516035 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_123 1521818 : 1523333 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_124 1527908 : 1531044 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_125 1534134 : 1536093 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_126 1542111 : 1543461 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_127 1549648 : 1553247 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_128 1556411 : 1558920 2 Yellowstone_lake_mimivirus(50.0%) NA NA
DBSCAN-SWA_129 1565980 : 1566589 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_130 1573688 : 1574798 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_131 1589546 : 1595571 4 Brucella_phage(66.67%) NA NA
DBSCAN-SWA_132 1608173 : 1613585 6 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_133 1622005 : 1632738 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_134 1636727 : 1641776 4 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_135 1651322 : 1653692 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_136 1658870 : 1663346 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_137 1667281 : 1670572 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_138 1682917 : 1684747 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_139 1688673 : 1692534 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_140 1710283 : 1714482 4 uncultured_marine_virus(33.33%) NA NA
DBSCAN-SWA_141 1718545 : 1730471 12 Indivirus(20.0%) NA NA
DBSCAN-SWA_142 1734587 : 1737968 3 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_143 1747660 : 1755259 10 Catovirus(20.0%) NA NA
DBSCAN-SWA_144 1767725 : 1772734 4 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_145 1776944 : 1778336 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_146 1784500 : 1793657 8 uncultured_Caudovirales_phage(60.0%) integrase attL 1776281:1776294|attR 1786526:1786539
DBSCAN-SWA_147 1797122 : 1800369 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_148 1804256 : 1805078 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_149 1809265 : 1810294 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_150 1821792 : 1825967 5 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_151 1831260 : 1833357 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_152 1859747 : 1860905 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_153 1871872 : 1872877 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_154 1878334 : 1880023 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_155 1883263 : 1884448 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_156 1895834 : 1896810 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_157 1900254 : 1901403 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_158 1906825 : 1914213 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_159 1921081 : 1927935 7 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_160 1933567 : 1937008 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_161 1948791 : 1949784 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_162 1952948 : 1960897 7 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_163 1973032 : 1975825 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_164 1979696 : 1982170 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_165 1993875 : 1996653 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_166 2017757 : 2019260 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_167 2027440 : 2030923 4 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_168 2042780 : 2047244 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_169 2062576 : 2065755 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_170 2084738 : 2086589 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_171 2096669 : 2098316 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_172 2124118 : 2125957 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_173 2149218 : 2150760 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_174 2155085 : 2156081 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_175 2164808 : 2165423 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_176 2211792 : 2213835 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_177 2218811 : 2219837 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_178 2239027 : 2240105 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_179 2243219 : 2246094 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_180 2249098 : 2253322 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_181 2258898 : 2260378 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_182 2263779 : 2265587 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_183 2282707 : 2285155 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_184 2288232 : 2288991 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_185 2292331 : 2294725 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_186 2299877 : 2300660 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_187 2306897 : 2310677 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_188 2327459 : 2328272 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_189 2338520 : 2345066 7 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_190 2350884 : 2356252 5 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_191 2364059 : 2367428 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_192 2387314 : 2391639 6 Prochlorococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_193 2405052 : 2407137 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_194 2420391 : 2421435 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_195 2440292 : 2441660 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_196 2445623 : 2449625 4 Pseudomonas_phage(50.0%) protease NA
DBSCAN-SWA_197 2457615 : 2484105 25 Staphylococcus_phage(18.18%) tRNA NA
DBSCAN-SWA_198 2488149 : 2489637 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_199 2492768 : 2494471 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_200 2497913 : 2509575 8 Micromonas_pusilla_virus(25.0%) protease NA
DBSCAN-SWA_201 2515016 : 2516912 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_202 2522597 : 2530389 10 Invertebrate_iridovirus(25.0%) NA NA
DBSCAN-SWA_203 2547768 : 2548914 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_204 2554598 : 2556893 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_205 2574080 : 2575046 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_206 2583058 : 2584546 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_207 2590258 : 2595381 3 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_208 2598977 : 2604301 4 Vibrio_phage(33.33%) tRNA NA
DBSCAN-SWA_209 2613620 : 2614862 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_210 2619999 : 2622834 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_211 2629818 : 2637928 8 Ralstonia_phage(25.0%) NA NA
DBSCAN-SWA_212 2647707 : 2656079 6 Stx_converting_phage(25.0%) NA NA
DBSCAN-SWA_213 2665190 : 2672294 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_214 2682240 : 2684025 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_215 2725582 : 2726737 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_216 2739507 : 2741056 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_217 2756430 : 2757663 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_218 2765451 : 2768325 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_219 2772777 : 2774211 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_220 2778627 : 2786216 7 Brevibacillus_phage(20.0%) tRNA NA
DBSCAN-SWA_221 2792928 : 2795829 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_222 2813879 : 2818879 4 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_223 2825816 : 2826854 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_224 2832832 : 2834992 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_225 2839710 : 2843861 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_226 2849290 : 2864740 9 Klosneuvirus(16.67%) tRNA NA
DBSCAN-SWA_227 2868012 : 2868768 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_228 2873585 : 2874428 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_229 2878914 : 2886997 5 Oenococcus_phage(25.0%) NA NA
DBSCAN-SWA_230 2890362 : 2893381 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_231 2896745 : 2897417 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_232 2911586 : 2913616 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_233 2916627 : 2920302 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_234 2925845 : 2931270 4 Cafeteria_roenbergensis_virus(33.33%) integrase attL 2923371:2923383|attR 2930977:2930989
DBSCAN-SWA_235 2940792 : 2946852 3 Liberibacter_phage(50.0%) NA NA
DBSCAN-SWA_236 2950215 : 2951937 1 Bdellovibrio_phage(100.0%) NA NA
DBSCAN-SWA_237 2956474 : 2957236 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_238 2976357 : 2977371 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_239 2985698 : 2986664 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_240 2992227 : 3000162 8 Bodo_saltans_virus(20.0%) tRNA NA
DBSCAN-SWA_241 3014414 : 3019684 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_242 3024542 : 3025148 1 Canarypox_virus(100.0%) NA NA
DBSCAN-SWA_243 3040934 : 3045215 4 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_244 3060030 : 3066117 3 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_245 3093130 : 3097456 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_246 3103685 : 3105194 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_247 3111382 : 3111658 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_248 3114827 : 3125141 6 Staphylococcus_phage(50.0%) integrase attL 3115068:3115080|attR 3130785:3130797
DBSCAN-SWA_249 3138126 : 3141687 4 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_250 3148485 : 3151059 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_251 3156704 : 3157157 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_252 3163914 : 3180974 19 Achromobacter_phage(12.5%) tRNA NA
DBSCAN-SWA_253 3187176 : 3198357 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_254 3205706 : 3212012 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_255 3225143 : 3230374 4 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_256 3239196 : 3245442 6 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_257 3259672 : 3259843 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_258 3266287 : 3274178 7 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_259 3283908 : 3284622 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_260 3306115 : 3325886 21 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_261 3340628 : 3341360 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_262 3345182 : 3348841 3 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_263 3358010 : 3359096 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_264 3367451 : 3368588 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_265 3375018 : 3376536 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_266 3380771 : 3381545 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_267 3386229 : 3387249 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_268 3396385 : 3399606 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_269 3418548 : 3419553 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_270 3441325 : 3453022 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_271 3457216 : 3465818 7 Tupanvirus(40.0%) NA NA
DBSCAN-SWA_272 3471120 : 3478638 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_273 3484330 : 3488639 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_274 3496495 : 3497353 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_275 3501122 : 3506261 4 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_276 3509988 : 3511509 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_277 3523655 : 3524210 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_278 3530773 : 3538620 8 Enterobacteria_phage(60.0%) tRNA NA
DBSCAN-SWA_279 3546515 : 3549461 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_280 3560948 : 3565039 3 Bacillus_phage(66.67%) tRNA NA
DBSCAN-SWA_281 3580062 : 3589393 7 Catovirus(25.0%) NA NA
DBSCAN-SWA_282 3594639 : 3601351 6 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_283 3606872 : 3610567 3 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_284 3615082 : 3625426 10 Catovirus(22.22%) NA NA
DBSCAN-SWA_285 3630936 : 3631836 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_286 3637379 : 3638552 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_287 3647595 : 3655388 4 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_288 3671210 : 3672512 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_289 3678876 : 3681657 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_290 3686062 : 3694185 8 Burkholderia_phage(40.0%) NA NA
DBSCAN-SWA_291 3718849 : 3719602 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_292 3727219 : 3727936 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_293 3743813 : 3745328 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_294 3757056 : 3834510 90 Enterobacteria_phage(30.0%) tRNA,holin,coat,portal,head,tail,capsid,protease,terminase NA
DBSCAN-SWA_295 3838425 : 3839901 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_296 3842960 : 3851146 7 Ralstonia_phage(85.71%) NA NA
DBSCAN-SWA_297 3858455 : 3908579 76 Salmonella_phage(24.14%) holin,head,tail,integrase,terminase attL 3857386:3857400|attR 3870386:3870400
DBSCAN-SWA_298 3917451 : 3919446 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_299 3931086 : 3931602 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_300 3937963 : 3946769 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_301 3951249 : 3952515 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_302 3966358 : 3967507 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_303 3971835 : 3975242 5 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_304 3982840 : 4001765 21 Escherichia_phage(10.0%) NA NA
DBSCAN-SWA_305 4009458 : 4010448 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_306 4035400 : 4037377 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_307 4041771 : 4042992 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_308 4049198 : 4054687 3 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_309 4061640 : 4064036 3 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_310 4084460 : 4086626 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_311 4094431 : 4095550 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_312 4099979 : 4101473 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_313 4109581 : 4110811 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_314 4117150 : 4122841 6 Phage_TP(50.0%) NA NA
DBSCAN-SWA_315 4126982 : 4128488 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_316 4131821 : 4132202 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_317 4142099 : 4143065 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_318 4149312 : 4151345 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_319 4188238 : 4189123 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_320 4197326 : 4201424 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_321 4213499 : 4216151 3 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_322 4222989 : 4225916 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_323 4236370 : 4238980 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_324 4245073 : 4246618 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_325 4249718 : 4257773 10 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_326 4263720 : 4264260 1 Leuconostoc_phage(100.0%) NA NA
DBSCAN-SWA_327 4268958 : 4271076 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_328 4297030 : 4338785 37 Escherichia_phage(20.0%) integrase,tRNA,transposase,plate attL 4295781:4295797|attR 4348660:4348676
DBSCAN-SWA_329 4351879 : 4352962 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_330 4370040 : 4379524 8 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_331 4388180 : 4388771 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_332 4393695 : 4398025 3 Tupanvirus(50.0%) protease NA
DBSCAN-SWA_333 4403974 : 4406932 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_334 4421206 : 4424103 3 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_335 4432318 : 4442516 10 Citrobacter_phage(25.0%) NA NA
DBSCAN-SWA_336 4458851 : 4459640 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_337 4463711 : 4472544 10 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_338 4475646 : 4478398 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_339 4488371 : 4489124 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_340 4495693 : 4506691 7 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_341 4510117 : 4518952 6 Ralstonia_phage(33.33%) NA NA
DBSCAN-SWA_342 4527367 : 4528357 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_343 4564997 : 4572240 6 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_344 4576098 : 4577658 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_345 4585090 : 4585300 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_346 4590564 : 4592613 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_347 4599831 : 4648875 73 Salmonella_phage(28.33%) integrase,head,terminase,holin attL 4615145:4615159|attR 4653300:4653314
DBSCAN-SWA_348 4665182 : 4666457 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_349 4669754 : 4671119 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_350 4674893 : 4675412 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_351 4682271 : 4693432 11 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_352 4704815 : 4709025 3 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_353 4712875 : 4715506 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_354 4728787 : 4729603 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_355 4732814 : 4735608 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_356 4740717 : 4747952 8 environmental_halophage(25.0%) NA NA
DBSCAN-SWA_357 4770136 : 4774881 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_358 4780201 : 4793621 15 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_359 4799736 : 4805444 5 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_360 4811638 : 4812466 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_361 4819796 : 4821017 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_362 4825624 : 4826245 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_363 4831166 : 4833074 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_364 4837902 : 4840020 2 Tupanvirus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP030081
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030081_1 27071-27221 Orphan NA
2 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP030081_1 1.1|27094|26|NZ_CP030081|CRISPRCasFinder 27094-27119 26 NZ_CP030081 Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence 27094-27119 0 1.0
NZ_CP030081_1 1.2|27143|56|NZ_CP030081|CRISPRCasFinder 27143-27198 56 NZ_CP030081 Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence 27143-27198 0 1.0
NZ_CP030081_1 1.2|27143|56|NZ_CP030081|CRISPRCasFinder 27143-27198 56 NZ_MG456577 Vibrio alginolyticus strain Vb1978 plasmid pVb1978, complete sequence 1368-1423 0 1.0
NZ_CP030081_1 1.1|27094|26|NZ_CP030081|CRISPRCasFinder 27094-27119 26 NZ_MG456577 Vibrio alginolyticus strain Vb1978 plasmid pVb1978, complete sequence 1319-1344 1 0.962
NZ_CP030081_1 1.2|27143|56|NZ_CP030081|CRISPRCasFinder 27143-27198 56 NZ_CP013800 Piscirickettsia salmonis strain AY6532B plasmid p4PS9, complete sequence 6454-6509 2 0.964
NZ_CP030081_1 1.2|27143|56|NZ_CP030081|CRISPRCasFinder 27143-27198 56 NZ_CP013819 Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence 16380-16435 2 0.964
NZ_CP030081_1 1.2|27143|56|NZ_CP030081|CRISPRCasFinder 27143-27198 56 NZ_CP013795 Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence 16380-16435 2 0.964
NZ_CP030081_1 1.2|27143|56|NZ_CP030081|CRISPRCasFinder 27143-27198 56 NC_013509 Edwardsiella tarda EIB202 plasmid pEIB202, complete sequence 20800-20855 2 0.964

1. spacer 1.1|27094|26|NZ_CP030081|CRISPRCasFinder matches to NZ_CP030081 (Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence) position: , mismatch: 0, identity: 1.0

aggtcgccagaagccaatctggagaa	CRISPR spacer
aggtcgccagaagccaatctggagaa	Protospacer
**************************

2. spacer 1.2|27143|56|NZ_CP030081|CRISPRCasFinder matches to NZ_CP030081 (Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence) position: , mismatch: 0, identity: 1.0

taatggcgaagcctcagcgccggccgaaggccagggggtttaggaacgccaggtag	CRISPR spacer
taatggcgaagcctcagcgccggccgaaggccagggggtttaggaacgccaggtag	Protospacer
********************************************************

3. spacer 1.2|27143|56|NZ_CP030081|CRISPRCasFinder matches to NZ_MG456577 (Vibrio alginolyticus strain Vb1978 plasmid pVb1978, complete sequence) position: , mismatch: 0, identity: 1.0

taatggcgaagcctcagcgccggccgaaggccagggggtttaggaacgccaggtag	CRISPR spacer
taatggcgaagcctcagcgccggccgaaggccagggggtttaggaacgccaggtag	Protospacer
********************************************************

4. spacer 1.1|27094|26|NZ_CP030081|CRISPRCasFinder matches to NZ_MG456577 (Vibrio alginolyticus strain Vb1978 plasmid pVb1978, complete sequence) position: , mismatch: 1, identity: 0.962

aggtcgccagaagccaatctggagaa	CRISPR spacer
aggccgccagaagccaatctggagaa	Protospacer
***.**********************

5. spacer 1.2|27143|56|NZ_CP030081|CRISPRCasFinder matches to NZ_CP013800 (Piscirickettsia salmonis strain AY6532B plasmid p4PS9, complete sequence) position: , mismatch: 2, identity: 0.964

taatggcgaagcctcagcgccggccgaaggccagggggtttaggaacgccaggtag	CRISPR spacer
taatggcgaagcctcagcgccggccgaaggccagggggtttcggaacgccaggcag	Protospacer
***************************************** ***********.**

6. spacer 1.2|27143|56|NZ_CP030081|CRISPRCasFinder matches to NZ_CP013819 (Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence) position: , mismatch: 2, identity: 0.964

taatggcgaagcctcagcgccggccgaaggccagggggtttaggaacgccaggtag	CRISPR spacer
taatggcgaagcctcagcgccggccgaaggccagggggtttcggaacgccaggcag	Protospacer
***************************************** ***********.**

7. spacer 1.2|27143|56|NZ_CP030081|CRISPRCasFinder matches to NZ_CP013795 (Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence) position: , mismatch: 2, identity: 0.964

taatggcgaagcctcagcgccggccgaaggccagggggtttaggaacgccaggtag	CRISPR spacer
taatggcgaagcctcagcgccggccgaaggccagggggtttcggaacgccaggcag	Protospacer
***************************************** ***********.**

8. spacer 1.2|27143|56|NZ_CP030081|CRISPRCasFinder matches to NC_013509 (Edwardsiella tarda EIB202 plasmid pEIB202, complete sequence) position: , mismatch: 2, identity: 0.964

taatggcgaagcctcagcgccggccgaaggccagggggtttaggaacgccaggtag	CRISPR spacer
taatggcgaagcctcagcgccggccgaaggccagggggtttcggaacgccaggcag	Protospacer
***************************************** ***********.**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 31135 32 Acanthamoeba_polyphaga_mimivirus(11.11%) transposase,integrase attL 9583:9601|attR 36998:37016
DBSCAN-SWA_2 37107 : 38637 1 uncultured_Mediterranean_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage