Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP029716 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 chromosome, complete genome 1 crisprs DEDDh,DinG,cas3,cas14j,csa3,WYL,RT 0 1 344 0
NZ_CP029717 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP029718 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed5, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP029721 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed3, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP029720 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP029719 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence 1 crisprs csa3 0 1 12 0

Results visualization

1. NZ_CP029718
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73513 : 97534 26 Salmonella_phage(25.0%) transposase,integrase attL 82513:82532|attR 94861:94880
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP029721
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029721_1 3109-3199 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029721_1 1.1|3135|39|NZ_CP029721|CRISPRCasFinder 3135-3173 39 NZ_CP029721 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed3, complete sequence 3135-3173 0 1.0

1. spacer 1.1|3135|39|NZ_CP029721|CRISPRCasFinder matches to NZ_CP029721 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccgagttagcccctcagatccccccccccccgccttc	CRISPR spacer
ttccgagttagcccctcagatccccccccccccgccttc	Protospacer
***************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP029716
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029716_1 1374549-1374710 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029716_1 1.1|1374601|58|NZ_CP029716|CRISPRCasFinder 1374601-1374658 58 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 15954-16011 12 0.793

1. spacer 1.1|1374601|58|NZ_CP029716|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 12, identity: 0.793

gatacgataaaaagccgggtggcggctacgccttacccggcctacatgttctacatat	CRISPR spacer
tcgcaaataaaaagccgggtggcggctacgccttacccggcctacatcgtctgcttga	Protospacer
     .*****************************************  ***.* *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1673 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_2 4684 : 8359 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_3 13951 : 16513 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_4 34373 : 35387 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_5 43717 : 44683 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_6 50293 : 58228 8 Bodo_saltans_virus(20.0%) tRNA NA
DBSCAN-SWA_7 72317 : 77586 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_8 82006 : 82612 1 Canarypox_virus(100.0%) NA NA
DBSCAN-SWA_9 93272 : 97571 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_10 104801 : 117546 17 Enterobacteria_phage(60.0%) integrase,transposase attL 106082:106099|attR 115912:115929
DBSCAN-SWA_11 131411 : 133743 2 Escherichia_phage(50.0%) integrase attL 126296:126308|attR 133860:133872
DBSCAN-SWA_12 149264 : 150335 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_13 157133 : 159707 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_14 165245 : 167157 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_15 172455 : 189513 19 Achromobacter_phage(12.5%) tRNA NA
DBSCAN-SWA_16 195715 : 206900 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_17 214271 : 220578 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_18 233772 : 239007 5 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_19 247831 : 255166 7 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_20 267284 : 267473 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_21 273899 : 282192 7 Prochlorococcus_phage(50.0%) transposase NA
DBSCAN-SWA_22 292747 : 293461 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_23 313850 : 316934 1 Herpes_simplex_virus(100.0%) NA NA
DBSCAN-SWA_24 320630 : 321581 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_25 325130 : 344953 22 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_26 359698 : 360430 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_27 364250 : 367909 3 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_28 377076 : 378162 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_29 386515 : 387652 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_30 394059 : 395577 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_31 399812 : 400586 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_32 405270 : 406290 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_33 415427 : 418675 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_34 437654 : 438659 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_35 460426 : 472202 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_36 476397 : 484995 7 Enterobacteria_phage(20.0%) NA NA
DBSCAN-SWA_37 490298 : 497816 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_38 503508 : 507817 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_39 515702 : 516560 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_40 520339 : 525477 4 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_41 529205 : 530726 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_42 541078 : 541633 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_43 548196 : 556042 8 Enterobacteria_phage(60.0%) tRNA NA
DBSCAN-SWA_44 563939 : 566547 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_45 585219 : 585885 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_46 590894 : 598479 7 Planktothrix_phage(40.0%) tRNA NA
DBSCAN-SWA_47 613464 : 622772 7 Catovirus(25.0%) NA NA
DBSCAN-SWA_48 627980 : 634692 6 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_49 640206 : 646485 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_50 652793 : 661489 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_51 666999 : 667899 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_52 673441 : 674614 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_53 683642 : 691434 4 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_54 702475 : 703178 2 Salmonella_phage(50.0%) holin NA
DBSCAN-SWA_55 715791 : 717093 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_56 723457 : 726238 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 730644 : 738767 8 Burkholderia_phage(40.0%) NA NA
DBSCAN-SWA_58 762684 : 763437 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_59 770507 : 772096 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_60 787535 : 789050 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_61 801410 : 902614 110 Enterobacteria_phage(25.0%) tail,coat,portal,protease,head,capsid,tRNA,terminase,holin,integrase,transposase attL 817149:817164|attR 846120:846135
DBSCAN-SWA_62 906804 : 907014 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_63 914444 : 916004 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_64 919862 : 927105 7 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_65 965331 : 966321 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_66 974724 : 988079 7 Salicola_phage(25.0%) NA NA
DBSCAN-SWA_67 996594 : 999346 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_68 1002448 : 1011291 10 Pseudomonas_phage(25.0%) NA NA
DBSCAN-SWA_69 1015362 : 1016151 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_70 1032486 : 1042345 11 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_71 1050562 : 1053459 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_72 1067734 : 1070692 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_73 1076639 : 1080969 3 Bodo_saltans_virus(50.0%) protease NA
DBSCAN-SWA_74 1085894 : 1086485 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_75 1095142 : 1104646 9 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_76 1121725 : 1122808 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_77 1136106 : 1143600 9 Escherichia_phage(40.0%) integrase,tRNA attL 1126012:1126028|attR 1144832:1144848
DBSCAN-SWA_78 1156232 : 1156991 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_79 1169578 : 1171696 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_80 1176393 : 1176933 1 Leuconostoc_phage(100.0%) NA NA
DBSCAN-SWA_81 1182880 : 1189955 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_82 1193633 : 1195178 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_83 1201268 : 1203878 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_84 1214937 : 1217854 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_85 1224642 : 1227294 3 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_86 1239369 : 1243467 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_87 1253584 : 1254469 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_88 1273508 : 1279174 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_89 1286191 : 1290156 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_90 1297250 : 1297631 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_91 1300965 : 1302471 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_92 1306612 : 1312304 6 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_93 1318643 : 1319873 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_94 1327971 : 1335025 5 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_95 1342694 : 1344860 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_96 1365232 : 1367629 3 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_97 1374701 : 1380190 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_98 1385863 : 1387084 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_99 1391478 : 1393455 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_100 1410491 : 1412465 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_101 1419732 : 1420722 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_102 1427005 : 1427245 1 Enterobacterial_phage(100.0%) NA NA
DBSCAN-SWA_103 1434041 : 1440208 6 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_104 1445892 : 1457055 14 Escherichia_phage(62.5%) NA NA
DBSCAN-SWA_105 1463939 : 1465088 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_106 1474036 : 1576322 123 Salmonella_phage(32.39%) protease,holin,head,tail NA
DBSCAN-SWA_107 1592628 : 1593903 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_108 1597199 : 1598564 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_109 1602338 : 1602857 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_110 1609714 : 1620876 11 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_111 1628533 : 1629349 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_112 1632560 : 1635353 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_113 1640461 : 1647696 9 environmental_halophage(25.0%) NA NA
DBSCAN-SWA_114 1669874 : 1674619 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_115 1678954 : 1693359 16 uncultured_Caudovirales_phage(11.11%) tRNA NA
DBSCAN-SWA_116 1699475 : 1705182 5 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_117 1711380 : 1712208 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_118 1719538 : 1720759 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_119 1725366 : 1725987 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_120 1730950 : 1732873 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_121 1737700 : 1739815 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_122 1746158 : 1808377 77 Escherichia_phage(17.07%) tail,plate,portal,protease,tRNA,terminase,holin,integrase attL 1776132:1776146|attR 1805885:1805899
DBSCAN-SWA_123 1814770 : 1824853 10 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_124 1830054 : 1830312 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_125 1842557 : 1844200 2 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_126 1847478 : 1848604 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_127 1862848 : 1863802 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_128 1878903 : 1879149 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_129 1883754 : 1884681 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_130 1892342 : 1892879 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_131 1897030 : 1900950 4 Pelagibacter_phage(50.0%) transposase NA
DBSCAN-SWA_132 1908212 : 1909280 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_133 1925662 : 1929620 6 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_134 1932914 : 1933664 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_135 1939294 : 1943935 5 uncultured_Caudovirales_phage(66.67%) protease NA
DBSCAN-SWA_136 1948165 : 1950220 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_137 1962709 : 1967946 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_138 1973381 : 1994364 22 Klebsiella_phage(26.32%) tRNA,integrase,transposase attL 1960537:1960552|attR 1997116:1997131
DBSCAN-SWA_139 2011559 : 2016109 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_140 2020285 : 2021374 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_141 2025432 : 2054388 22 Tetraselmis_virus(14.29%) protease,tRNA NA
DBSCAN-SWA_142 2071376 : 2074079 1 Orgyia_leucostigma_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_143 2090427 : 2091156 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_144 2094284 : 2110409 19 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_145 2116005 : 2118056 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_146 2125542 : 2127414 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_147 2130626 : 2134753 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_148 2142325 : 2143921 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_149 2147210 : 2152086 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_150 2155197 : 2158857 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_151 2173084 : 2178224 7 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_152 2181757 : 2182411 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_153 2189647 : 2196911 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_154 2206609 : 2207518 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_155 2214741 : 2218178 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_156 2226447 : 2232976 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_157 2237300 : 2240771 4 Edwardsiella_phage(33.33%) NA NA
DBSCAN-SWA_158 2275568 : 2276360 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_159 2279456 : 2285820 5 Hokovirus(50.0%) NA NA
DBSCAN-SWA_160 2289092 : 2289770 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_161 2296450 : 2297224 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_162 2301424 : 2305211 2 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_163 2309818 : 2311483 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_164 2315391 : 2316438 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_165 2322265 : 2327388 4 Planktothrix_phage(50.0%) tRNA NA
DBSCAN-SWA_166 2333779 : 2336237 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_167 2341027 : 2341840 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_168 2361976 : 2368285 6 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_169 2372962 : 2373235 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_170 2379573 : 2383990 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_171 2395875 : 2400623 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_172 2406806 : 2415457 8 Brazilian_cedratvirus(33.33%) holin NA
DBSCAN-SWA_173 2419955 : 2421483 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_174 2434605 : 2437314 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_175 2445374 : 2445662 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_176 2449836 : 2450808 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_177 2461452 : 2465726 4 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_178 2477849 : 2478716 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_179 2482499 : 2483885 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_180 2491993 : 2492680 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_181 2495812 : 2496484 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_182 2499514 : 2502013 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_183 2511982 : 2517527 5 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_184 2524296 : 2531350 6 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_185 2535599 : 2543489 6 Herpes_simplex_virus(33.33%) transposase NA
DBSCAN-SWA_186 2548246 : 2551775 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_187 2556154 : 2556850 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_188 2560021 : 2565069 4 Sodalis_phage(25.0%) protease NA
DBSCAN-SWA_189 2579043 : 2580543 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_190 2601184 : 2602846 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_191 2606428 : 2610768 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_192 2622587 : 2631575 6 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_193 2635182 : 2636286 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_194 2644199 : 2645360 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_195 2653860 : 2654628 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_196 2661537 : 2667714 4 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_197 2680915 : 2681494 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_198 2690107 : 2697717 8 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_199 2701773 : 2702541 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_200 2709092 : 2710124 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_201 2722089 : 2726207 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_202 2735033 : 2735792 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_203 2747169 : 2748603 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_204 2752538 : 2752883 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_205 2758807 : 2759605 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_206 2769878 : 2776652 6 Bodo_saltans_virus(50.0%) tRNA NA
DBSCAN-SWA_207 2789233 : 2795775 5 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_208 2804002 : 2805427 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_209 2816364 : 2816928 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_210 2821119 : 2822163 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_211 2848114 : 2849839 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_212 2856991 : 2858361 1 Macacine_betaherpesvirus(100.0%) transposase NA
DBSCAN-SWA_213 2864472 : 2865171 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_214 2871428 : 2876820 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_215 2884459 : 2885827 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_216 2895365 : 2896514 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_217 2906941 : 2920769 12 Tupanvirus(20.0%) tRNA NA
DBSCAN-SWA_218 2934179 : 2941464 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_219 2947954 : 2949277 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_220 2954737 : 2957535 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_221 2961273 : 2962338 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_222 2969604 : 2970884 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_223 2974736 : 2976401 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_224 3012140 : 3019604 4 Bacillus_virus(50.0%) protease NA
DBSCAN-SWA_225 3025383 : 3026205 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_226 3035885 : 3036470 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_227 3040169 : 3043109 2 Shigella_phage(50.0%) integrase,transposase attL 3035344:3035358|attR 3047158:3047172
DBSCAN-SWA_228 3061636 : 3071787 7 Paramecium_bursaria_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_229 3081716 : 3084425 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_230 3097851 : 3105975 7 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_231 3129152 : 3130802 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_232 3143150 : 3145082 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_233 3149057 : 3162039 11 Lactococcus_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_234 3165955 : 3166501 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_235 3173786 : 3174764 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_236 3180657 : 3181188 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_237 3187478 : 3189458 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_238 3206292 : 3207795 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_239 3214278 : 3215067 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_240 3220723 : 3222367 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_241 3228458 : 3229991 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_242 3234995 : 3236510 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_243 3241125 : 3250753 7 Bacillus_phage(33.33%) transposase NA
DBSCAN-SWA_244 3256832 : 3258182 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_245 3264415 : 3268020 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_246 3271193 : 3273702 2 Yellowstone_lake_mimivirus(50.0%) NA NA
DBSCAN-SWA_247 3280762 : 3281371 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_248 3288470 : 3289580 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_249 3306657 : 3310341 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_250 3322943 : 3328356 6 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_251 3336775 : 3347567 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_252 3351556 : 3356605 4 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_253 3366166 : 3368536 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_254 3373736 : 3378213 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_255 3382148 : 3385439 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_256 3397783 : 3399613 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_257 3403539 : 3407400 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_258 3423895 : 3428094 4 uncultured_marine_virus(33.33%) NA NA
DBSCAN-SWA_259 3432157 : 3444083 12 Indivirus(20.0%) NA NA
DBSCAN-SWA_260 3448199 : 3451580 3 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_261 3461272 : 3468871 10 Catovirus(20.0%) NA NA
DBSCAN-SWA_262 3483253 : 3486341 3 Abalone_herpesvirus(50.0%) NA NA
DBSCAN-SWA_263 3490551 : 3491943 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_264 3498152 : 3507312 8 uncultured_Caudovirales_phage(60.0%) integrase attL 3489175:3489188|attR 3502546:3502559
DBSCAN-SWA_265 3510777 : 3515980 5 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_266 3529127 : 3533302 5 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_267 3536967 : 3539064 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_268 3559048 : 3560206 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_269 3571301 : 3572306 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_270 3577814 : 3579503 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_271 3583614 : 3584799 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_272 3596237 : 3597213 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_273 3600593 : 3601742 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_274 3607164 : 3614553 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_275 3621423 : 3631931 9 Moraxella_phage(20.0%) NA NA
DBSCAN-SWA_276 3643714 : 3644707 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_277 3647871 : 3655809 7 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_278 3667968 : 3670761 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_279 3674681 : 3677155 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_280 3688859 : 3691637 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_281 3718287 : 3719790 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_282 3727994 : 3731477 4 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_283 3743309 : 3748278 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_284 3775574 : 3777425 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_285 3787502 : 3789149 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_286 3814821 : 3816660 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_287 3840338 : 3841880 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_288 3846205 : 3847201 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_289 3855868 : 3856483 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_290 3902573 : 3904616 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_291 3909593 : 3910619 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_292 3914087 : 3918191 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_293 3937366 : 3938444 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_294 3941567 : 3944442 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_295 3947473 : 3951698 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_296 3957319 : 3958799 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_297 3962251 : 3964059 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_298 3982147 : 3984595 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_299 3987703 : 3988462 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_300 3991802 : 3994196 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_301 3999371 : 4000154 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_302 4006392 : 4010164 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_303 4026946 : 4027759 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_304 4038069 : 4044635 7 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_305 4050453 : 4055867 5 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_306 4063674 : 4067043 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_307 4086930 : 4203134 109 uncultured_Caudovirales_phage(35.29%) tail,portal,head,protease,capsid,tRNA,terminase,integrase attL 4106111:4106127|attR 4135345:4135361
DBSCAN-SWA_308 4207178 : 4208667 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_309 4211798 : 4213501 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_310 4216943 : 4228606 8 Micromonas_pusilla_virus(25.0%) protease NA
DBSCAN-SWA_311 4234046 : 4235942 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_312 4241626 : 4249417 10 Invertebrate_iridovirus(25.0%) NA NA
DBSCAN-SWA_313 4266743 : 4267889 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_314 4273573 : 4275868 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_315 4292988 : 4293954 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_316 4302152 : 4303640 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_317 4317390 : 4322513 3 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_318 4326247 : 4378301 65 Cronobacter_phage(56.0%) tail,portal,head,protease,capsid,terminase,tRNA,holin,integrase attL 4356002:4356047|attR 4372171:4372216
DBSCAN-SWA_319 4387606 : 4388848 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_320 4393985 : 4396820 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_321 4403803 : 4415329 10 Ralstonia_phage(20.0%) NA NA
DBSCAN-SWA_322 4428355 : 4431134 2 Stx_converting_phage(50.0%) NA NA
DBSCAN-SWA_323 4453504 : 4462828 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_324 4468163 : 4469313 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_325 4472786 : 4474726 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_326 4483894 : 4490997 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_327 4500899 : 4502684 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_328 4532946 : 4534101 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_329 4546948 : 4548497 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_330 4565385 : 4566618 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_331 4574461 : 4577335 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_332 4581787 : 4583221 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_333 4587663 : 4598969 10 Brevibacillus_phage(12.5%) transposase,integrase,tRNA attL 4594108:4594122|attR 4598636:4598650
DBSCAN-SWA_334 4603641 : 4606611 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_335 4624680 : 4629683 4 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_336 4636620 : 4637658 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_337 4643637 : 4645797 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_338 4650515 : 4654667 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_339 4660096 : 4675419 9 Klosneuvirus(16.67%) tRNA NA
DBSCAN-SWA_340 4678691 : 4679447 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_341 4684264 : 4685107 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_342 4689594 : 4697677 5 Oenococcus_phage(25.0%) NA NA
DBSCAN-SWA_343 4701042 : 4704061 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_344 4707425 : 4708097 1 Vibrio_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP029719
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029719_1 1293-1427 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP035636 Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence 100226-100264 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP017182 Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence 1315-1353 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP017182 Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence 1402-1440 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP031569 Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence 7815-7853 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP050011 Citrobacter sp. Y3 plasmid unnamed2, complete sequence 27572-27610 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP019840 Enterobacter roggenkampii strain R11 plasmid pASM1, complete sequence 70340-70378 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP022149 Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence 50338-50376 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP009855 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence 14593-14631 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP008907 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence 83191-83229 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP026851 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1 65584-65622 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_LT991956 Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-p2 52487-52525 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP029719 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence 1341-1379 0 1.0
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 20127-20165 1 0.974
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NC_014107 Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence 48095-48133 1 0.974
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP046273 Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence 40032-40070 1 0.974
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP012169 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence 40032-40070 1 0.974
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP042541 Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence 40032-40070 1 0.974
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP031723 Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence 50311-50349 1 0.974
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP042567 Enterobacter hormaechei strain C44 plasmid pC44_001, complete sequence 40032-40070 1 0.974
NZ_CP029719_1 1.1|1341|39|NZ_CP029719|CRISPRCasFinder 1341-1379 39 NZ_CP039454 Enterobacter bugandensis strain 220 plasmid pSurvcare220, complete sequence 72766-72804 2 0.949

1. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

2. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

3. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

4. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

5. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

6. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP019840 (Enterobacter roggenkampii strain R11 plasmid pASM1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

7. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

8. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

9. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

10. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

11. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_LT991956 (Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-p2) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

12. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP029719 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
***************************************

13. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.974

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
gacggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
*.*************************************

14. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 1, identity: 0.974

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
gacggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
*.*************************************

15. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 1, identity: 0.974

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
gacggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
*.*************************************

16. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 1, identity: 0.974

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
gacggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
*.*************************************

17. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 1, identity: 0.974

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
gacggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
*.*************************************

18. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP031723 (Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence) position: , mismatch: 1, identity: 0.974

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
gacggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
*.*************************************

19. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP042567 (Enterobacter hormaechei strain C44 plasmid pC44_001, complete sequence) position: , mismatch: 1, identity: 0.974

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
gacggggttgaaggatgagttctgacacgcaagtaggag	Protospacer
*.*************************************

20. spacer 1.1|1341|39|NZ_CP029719|CRISPRCasFinder matches to NZ_CP039454 (Enterobacter bugandensis strain 220 plasmid pSurvcare220, complete sequence) position: , mismatch: 2, identity: 0.949

ggcggggttgaaggatgagttctgacacgcaagtaggag	CRISPR spacer
ggcggggttgacggatgagttctgaaacgcaagtaggag	Protospacer
*********** ************* *************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7127 4 Macacine_betaherpesvirus(75.0%) integrase attL 2947:2959|attR 8020:8032
DBSCAN-SWA_2 11031 : 12714 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_3 15901 : 19223 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_4 22595 : 29852 5 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_5 34946 : 37024 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_6 48444 : 53085 3 Virus_Rctr85(33.33%) transposase,integrase attL 45204:45217|attR 50843:50856
DBSCAN-SWA_7 60292 : 61452 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_8 65093 : 69372 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_9 95611 : 95935 1 Enterobacterial_phage(100.0%) NA NA
DBSCAN-SWA_10 109282 : 112039 5 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_11 120840 : 126332 6 uncultured_Caudovirales_phage(80.0%) transposase NA
DBSCAN-SWA_12 133921 : 138778 8 Faecalibacterium_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP029717
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10549 : 49041 45 Escherichia_phage(47.06%) integrase,transposase attL 22079:22138|attR 43765:45123
DBSCAN-SWA_2 163430 : 275785 115 Escherichia_phage(26.32%) integrase,protease,transposase attL 238378:238437|attR 256633:260980
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage