Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028484 Escherichia coli strain E41-1 plasmid p1, complete sequence 0 crisprs RT 0 0 2 0
NZ_CP028483 Escherichia coli strain E41-1 chromosome, complete genome 4 crisprs c2c9_V-U4,csa3,cas3,DEDDh,RT,DinG 0 4 11 0
NZ_CP028485 Escherichia coli strain E41-1 plasmid p2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 0 crisprs RT 0 0 0 0

Results visualization

1. NZ_CP028484
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 889 : 58708 55 Escherichia_phage(35.71%) transposase,protease NA
DBSCAN-SWA_2 75075 : 81115 8 Escherichia_phage(71.43%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028483
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028483_1 2345019-2345142 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028483_2 3023314-3023405 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028483_3 3223300-3223382 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028483_4 4111572-4111704 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028483_4 4.1|4111589|42|NZ_CP028483|PILER-CR 4111589-4111630 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP028483_1 1.1|2345062|38|NZ_CP028483|CRISPRCasFinder 2345062-2345099 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP028483_2 2.1|3023340|40|NZ_CP028483|CRISPRCasFinder 3023340-3023379 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 2 0.95
NZ_CP028483_4 4.2|4111648|40|NZ_CP028483|PILER-CR 4111648-4111687 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95

1. spacer 4.1|4111589|42|NZ_CP028483|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

2. spacer 1.1|2345062|38|NZ_CP028483|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 2.1|3023340|40|NZ_CP028483|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 2, identity: 0.95

gcgctgcgggtcatttttgaaattacctccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.***********.************

4. spacer 4.2|4111648|40|NZ_CP028483|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *********************.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 836280 : 868179 24 Stx2-converting_phage(38.46%) protease,transposase NA
DBSCAN-SWA_2 1173899 : 1181039 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_3 1773962 : 1783407 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 1877583 : 1883886 6 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_5 1907033 : 1943331 40 Stx2-converting_phage(21.43%) transposase NA
DBSCAN-SWA_6 2066474 : 2148984 95 Escherichia_phage(24.39%) terminase,plate,portal,capsid,integrase,tail,holin,tRNA attL 2066289:2066348|attR 2108901:2109025
DBSCAN-SWA_7 2646640 : 2718896 80 Stx2-converting_phage(27.12%) terminase,transposase,portal,capsid,integrase,head,tail,protease,holin attL 2697685:2697699|attR 2719161:2719175
DBSCAN-SWA_8 2856855 : 2902564 58 Enterobacteria_phage(56.0%) terminase,lysis,portal,capsid,integrase,head,tail,holin,tRNA attL 2875639:2875653|attR 2904233:2904247
DBSCAN-SWA_9 3099672 : 3226221 145 Enterobacteria_phage(42.0%) terminase,plate,transposase,capsid,portal,integrase,head,tail,protease,holin,tRNA attL 3169600:3169619|attR 3208257:3208276
DBSCAN-SWA_10 3983044 : 4026872 43 Salmonella_phage(25.0%) bacteriocin,tRNA,transposase NA
DBSCAN-SWA_11 4282061 : 4338859 51 Stx2-converting_phage(28.57%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage