Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021168 Enterobacter hormaechei strain 388 plasmid p388, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP021167 Enterobacter hormaechei strain 388 chromosome, complete genome 2 crisprs DEDDh,csa3,WYL,DinG,cas3 0 2 5 0

Results visualization

1. NZ_CP021167
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021167_1 1169294-1169398 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021167_2 2043331-2043454 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021167_2 2.1|2043374|38|NZ_CP021167|CRISPRCasFinder 2043374-2043411 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP021167_1 1.1|1169322|49|NZ_CP021167|CRISPRCasFinder 1169322-1169370 49 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 33521-33569 3 0.939

1. spacer 2.1|2043374|38|NZ_CP021167|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cagacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
********..****************************

2. spacer 1.1|1169322|49|NZ_CP021167|CRISPRCasFinder matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 3, identity: 0.939

gccggtgtccagcccaaacgcagtcgtaccaatgcctgcggaggtggaa	CRISPR spacer
gccgatgtccagccaaaacgcagtcgtaccaatgcctgcggaggtggat	Protospacer
****.********* ********************************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1157058 : 1197765 65 Enterobacteria_phage(28.3%) capsid,terminase,coat,lysis NA
DBSCAN-SWA_2 1835896 : 1884663 62 Enterobacterial_phage(31.48%) terminase,tail,tRNA,portal,head,holin,integrase,capsid attL 1831721:1831735|attR 1891694:1891708
DBSCAN-SWA_3 2452843 : 2514705 65 Escherichia_phage(23.4%) terminase,tail,plate,tRNA,holin,integrase attL 2501260:2501275|attR 2515627:2515642
DBSCAN-SWA_4 2990866 : 2997144 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_5 3435464 : 3514607 83 Salmonella_phage(70.21%) tail,plate,lysis,tRNA,terminase,portal,integrase,capsid attL 3480406:3480455|attR 3514816:3514865
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021168
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 76921 70 Escherichia_phage(31.03%) integrase,transposase attL 33650:33666|attR 72044:72060
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage